Description :
From Genome Similarity Track
Location :
Scaffold_23:54656- 59261
Transcript NameFunction/comments
Hyaar_Emoy2803758histone acetyltransferase, putative
Hyaar_Emoy2803759conserved unknown protein
Hyaar_Emoy2803760PREDICTED: nesprin-1

Sequence
4605 bases(100 bases per row)
CACGACGCAAAAAATCTTGAATAAATATGCTGAGTTCACAACTCGGAATGTCAAGGCATGAGCTGTTCTGCGCGTGCTCATCGGGATCGGGATCGGGCTG
CAAGATCCTGCGCATGGATGACTTGAGTAGAGAAGAAGCGCGCTCGCGCCGGCATCGGCAGAGCGGGCACACGTACGAACAAGTCTTAAAAGGCAAGCCA
CTAGAAGCCGTGCTCGAGGCCTTCTGAGACCCGTAAGCCCCGATCACAGGGTTATACAGTCCACACACTTGGTGTAGCCACCGGTCGCACTCACCGCACT
TTACCCAAGGTTCCACACCAAGCTCGCACTTTTTCTTTATGAGAGAGTCCACCAACGCAGCCGCTTGATCATCTTGTGCATGGGGTCGAGACAAACGACT
TCTGCACTTGTGACACCAAACGCGAGTGCCATCTTCCGAAATAAAATATACCGAGCCCTTGCGGATTTCGGTGCTACAGCCAGCCGAGCACTGTAGGTTC
GGCTGAGCGACGTCCAAGCACTGCTGCTGGCAAACGATGCAGGTGTTTCCCCGACACACCAGACATACATGTTGCACGCTTTGCCGCTTCGCCCCTCGAC
TTTGTTCGGCTTTTACGGATTCATTAAAGCGCTTAAGCAACAGTCCAGCATCCACATGGATATAATGCGACTCGGGGTTGAAAAGCATTGCATTCTCAAA
CACTAATTTGACGTCAGAAACGAACTCGTCCAGCTCAAGATATTCTCCGGCAGCAATGTTGCGTTTGATGGTGCCAAGATCCATGGGGTGCCGCACAATC
GTCGTGTAGGTAGGTAATTGCAAAGCCACTGGATCCACAGGTGTGTTAAATACACCATGACGATTTCTGGGGTCAGACATGAGCTTCAATAAAATATCCG
TCACTCTATCAAAACTTTTAATGCGACCTTCCCGACGAAGGGACGCAATATGTCGTGCAATCTCGTCCGCTGTCATCTGTAACATCGGATCCACCGTTAC
AAAATTCGCCGGTTGTAATTCCTCCCCACTTATATTCCGTTTTCCGTCATCACTGAGTGGGTGCCACCCAACAGGTAAGCTCCTATTTTCACCAAGTGTT
CGACAATCCTGTGGCAAAGGTTCCGTAAGCTTCTGACAGACACTTGTACCACTCGGGCTCTTGACATTCACATCTTGAAGCGACGTCACGGGTAGCGCAC
CTACCTTACCGCTACCTCGCTGATGCTTGCGCGGCGAAGATGCGGTAGGTCGATTAGACGTAGCTACACCATCATCAAATGCTACACTGCGTGGGCGTTT
CCGTACCTCACCTCTAGGAGACTTTGACTGCACCGTTTTCGTACTCTTGGTAGGACTCTTCGCCCTGGAGTGGACCCTATTCCCGGCTAAGTCATTTGTT
GCACCCACTCCAGCCTCCTGAGGCGGTGCACGTATAGACAATCCTTGCTGTTTGGTAGCAGCTTTACTGCTGATATGAGTTGTGGAAACGTTGTGGCGTT
GCCGCGATAATTGAAGCGGCCGCACTCTTAGCGTAACGGGACGTGGCAGCAACGTTGGACGAGTCATGGGGCCGGACCTTCGACGATGCGGCGGTATGGG
ACAACTGAACACGATTTTAGTCCATTCGGACTGCACGAGGCGCTCGCTTGCCAGCCCTGCCTCGACAGCCGAGCTCAGTTTGCGCCAGAGTAAGTACTTG
ACGAATTTGACATAAAACTCACTTGACGCGCCTAGCCCTGCTGAAATGAGTTCTTAGGCGAGACACAGGAGTCAACGTTAGCGACACCACAACCTCCAAC
ACAGTTTCAAGCCAGCCAGCGAGCCACAGCACGCACCAATAAGTAGTCGTAAAACACTAGCACTAGGCGTCTGTCGATCCCCATAAAATAGCAAAAAAGC
TGCATCTTCTTCCCCAAGGCGCCGCTTCCGCACTCTCAACGCGCAATGCTCGTTCCGCATCGTGACCTGCTGCTGCATCTTCATTGTTTCCTGTTGCTTC
TCCTCCACAGAGTCCTCCAATACAATCTCCTCTTCCTCCTCCTCGTCCAGTTCCAGCACTTCCAACTTCCTCTTGAGTCGCACAGGCTTCTCCACGTCGT
CTTCTTCCACCCCGTCCAGATCCTTTTCCTTTTCCTCTTCATCTTCACTGCTGCAGTCGATTGTAACCACCTCTGGCTCAGCCGCGGCCTTCACGCCAGT
TGAACCGTCGACCGTTGGCTGCAAAACCACCACCTCCTCGTCCTCCTCCTCGCCCTCGCTGCTTATACTGATACACACTCGTCCTCCCGCACTCCACTTG
CCTCTAACAACAGAGCGCTCGTCAATTAACTGAAGCGTGGCCTCACGATCGCGCCGCAAACGCGCCAAGCAGCGACTCGGAGCCTTCATTGCCGTCCACT
TGAGCCAAAAAAACCGCAGGTGCACTTCTCATTGGTCAATTGAAGATACAGTCGATCGATTGGCTAAATCTCGTCACTCTGATCTTTGACGTTCTGCTGT
GGGTCCTGTTTTGTTAACATGGCTACATTCAGGTATCATCAAACCGCATCAAAACTCGCAACCATCATGGCTATATCGAATCTCCAAGCCTTCACGCAAT
CATCATGGCTACATACTGTCCCCTCTTGGCTACATACTGTCTCCTCATGGCTACACTTGAGCTCCTCATCACCGTTTCGTCATCTCTGATGGAGGTGGCA
CGTTCTCCATCGCGTCAACGTTGATGCGAGCGTTACCAGTCGCTTCCCGTCGTTTTGACCGCGTCAAGTCGCAGTCGCTCTCGTCCCACGTCACGACAGT
CAGTCACGCCACGCGCTTCGGCCTGTTCCCGTCACTTTGCCACTTGCCGGTTCGACCCCATGCACATCACAGCCGAGCAGACGCGATTGGGGCAGCAGCA
GCAGCCAACCGTCGACTCTCCTGCAGTCACAACCACCACTACAATAGCAGCTCGACGTGGCGACTGGACTTTGACTCCACTGCCGCTGCCGCTGTCGCCC
GTGGTTGTGCCTTCATCTTCTTCGTCTTCTTCTTCGCCTATTGAGACAGCAACTGTACCCATTTTCCCGTCCAAACGACTCAATTGGACGCGTCGGCTGG
TGATTACCAAGCAGCCGCTGTCGGAGTTTTACAAGGATGAAGGCGGTAAAGCCAATGCCCTCGAAGTCGAGGTGACGCTCGTGGAATTTGACGAACACGG
CGAGCCCGCGCGGTCCAGCGACAAGGAGTTTATTGACATTCCGCTGCGGATTTTACTGTTTTTCGAGTCGGGGAAGCGCGTGGACGATACGGACCAGGAG
ATTTTTCGATTTGTCGGCAACGACTACGACTCGGTCGTTATTCGAGCTGCTACGCGCACGGCAGTGGTGCAATTTCGTCTCGAGAAGGTGAGCAGACGGA
AGGATGGCCAGCGGTTTAAGCTGCGAATTGAAGTGGACCAGGAACAGTGCACTGCGAACGTGGCGGACCTCACGCCAGTGTTTACGAATGCAATCTGTGT
GCTGTCCAAGCGGAAACATCCGAGTCCGTACAGCTCGGACTCGTCGATTCGCGTGAAAGAGCCTCCTCCCAAACTGCTCAAACGAGGTACAGTTGCACTC
TATCGTTCATGGTGTTGTCACACGTTGCGTTACATCAGGCATGTGTTACGCTTTTCGCTGCGTGCTGCAGACTTGGCGATGTTGGAAGATCGAATGAGCA
GGAAGATCGATGGACTTGCAGCACAAGTCCATCATCTGACTCAATTAGTACAGAAGCAGGTTGGTTGAATGTGACTGGATGGACCTTTGACGTGATCGTG
CACTTTACTTACTGGACGTTATGTGACGTGACAGAATGAGCTACTTGTCAAGCACCGCATGCCTGCCATTCCACCGGGACCGGGACTGCAATCGGCTCCA
ACTGAGAGCTCTATTCTTGAATGGCTGCTTCGATCGAATCCTGTGGATGACGGCACTTGGTCCAAGCCAGCTCTGGAGCCACATTTACTTCCGAACACCG
TCATGCCTTATTTCGAGCTCGGCGACGAGCCATACCACGGCATAGACGCAGACCTCACATCCGCACTCGTTGGGCTACCAACCACGACTGCAACAACAAC
GACAACCACATCAGATGCGCACACGAGCGAGACATCGATGCCGTCGCTACCATTTGGCGACATTTGACGTGCTGCGTCCAAAATTGTAGGTACTTGTTCA
ATTTTCGCCGACCGACTACTACCCAGCGTGCTCGAAAATACAGTATGCAGCCCCGCTTGACGCGTCGTCTGCCTCTTTTTTGCTGCTACTGTCCACTGAC
ATCGCTGGTTCCTGTCTCGAGAAAGTGTCGAAAGTCGCCCACCACTTGCACAAGCTTGCCTGCTGTCTGGATCTGGCGATGCAGGTCCACGTTCTTGGGA
CTCTTTTCCATAAGGTACAGCAGCTTTTCTTTCCGTCGAAGCTGTACCAAGCGACATACATCAGTACAAAGCCTGCTTGTATCCCCTATCTAGCCCCGCA
ACGAGAAATACCGTACAATTTCTTTGTAGAGCTCGTCACAGACCAAATTGAACTGCTCGAGCTTCTTGATCACTTGGTCCTCCGCACTGCTCGGCTCGTC
CCTCT