Description :
From Genome Similarity Track
Location :
contig_128:54655- 57618
Transcript NameFunction/comments
g11524.t1hypothetical protein
g11525.t1hypothetical protein

Sequence
2963 bases(100 bases per row)
GCGTCCTGGGTAGGGGCGGGCCCCAGCGCTCGCGGGCTTGTTGCTCGGCGTGGTCCGGGTCGACGACAAGAGCGGAGCTCGCTAGCGGGGGGTCGCTGCG
AGCTTCGGGGGGTCTTGGCGGGGGGAGTCGGGCGTGACAGTGGCCGCCTTGACAGTGGCGTTGGCTGCACCAGCAGTGGGGCTCAATTCCCCTGCTGCCG
GCGCAGCCGCTGCCGAGAAGGTGCGGTTGAGGCTGGCGCACGCGTGTGCGTGGTTTGCAGCAGCCAGCCTCGACGCGAAGGGCACACCGCACGCACATCC
CGCCGAGAACCGGTCGAGGAAGGCAGTGCGGCGGTGCCGGGAGTCCCGGTGTCGCTTGAGCGACGCGAAGCTGGCGGCCGTGTACGTGCACAGCGTGCAC
TGGAAGCGCTGCGCATTGTGCGCGTACACGGAGAGGACGGAGGCCGGGCGAGCGCTGGCCGCGGATAGCCTAGGCGCTGGAGCGTGGTCCCCAGCCTCGT
CCTCCTCCTCGAGCAGGAGCTCGGCCAGCTCGCGGGTGTCTTCGTCGTCGACGTCGTTGAGACGTCGACGCTTGCCGCCGACGCGCTGCCATGGCGGCTG
CTGTCGGCGGGCACCTTGGTCAACATCCATGGCGACGACGCCGACGTCGCCTGCTGCATCGCTGCTGCCTGCGCCGTCGTCGCCGTCGCCGCTCGCGTCC
GTCGTCCTGCTGCTGCCGTCGCTGCTGACCACGTCGCCCGACATGGGCTCCACGCGCGCGCTAGCTGGGGGTGCTTGTTCTTGGGGCGGCTCGGCGCGCG
CGGGGCTCCACGGCGGCGCGGCCAACAGGAGAGGTGGCAGGGGCAGCTGCGACTGCCGTCACCAGTGGGGCGGCAGCAGCCGCAGCTGGGCTCGGCGGCG
GAGCGCTTGGGGGCGGCGGGGTGATGCCTGGTCGGCGAGCATGCGCCCGCCCTTGCGGGTGAGGGCAGCACATTCGCGGGGGATTCGGGGGCCGGCGGCC
CGTGCGCACAAGCGGCGGAGTTGCGGGGGGCCGGCGCCGCGGCAGCAGCGGCTGCGGGCGTCCAGGGTGACCCACCGGCGGGCAGCATGCATGCCGCCCT
GCCGGGTGGGCCATCATCGCGTGGGGGTCGTGGCGGCGGCTGGCGGCGGCGGCGCGGTCGTCCGGCGCGTCCTCTTCGTCGCTGTCGTCGTCCTCCAGCT
CGCGGGGCCGTACGCGGCCGCGAGAGCGCGAGCCGTGGCGGCTGCAAGCGCTTCCCCTGGCACGACCGGCTCGGGCAGCATGCCGCTCGCCCTGCCGGGT
CGTGCCACATCACAGGGGGGAGCTGGGCGCGGCGACGGGCGGAGAGGCGGGCGAGGGACCTTGGCCAGCCAACGGGCGCGCGTGGGGGGCGGCGGACGTC
TGGGGCCGTCGTGGCGGCCGGCGCTCGGCGGCGCTTCTTCGGCGGCCGGCCGTACGGGCTGAGAAGGCTCCGTTTGTGGAAGCGTCGCCCGTACGGCCTG
AGAGGCCAGCATTCGGCCGATAGTGGGGCCGAGTGGGGAGGGGTGCGCCGACCTCCCGCCCGCACCAGCGGACCGTCCACTGTCGCCAGCGGACGGTGGA
TCCACCCGTGGATCCCCGAAACGACGCGAGGTCGTGGAGGCGGGGCGGGGCGTCTCTTGGCCGGCAGCGGCCTCGAGGCGCGTGAGGGGTCGCGGTGCAA
TGGGCGCTGCGGGTCCCGGACCCGTGCCCGAAGTTGCAGCCGCTGAAGCGTCGCCGGTGCCGAGCAGCGGCACCGCGCGTGGAGGCTCTCGGGGTCCGTT
TCGGGCCCGGAAAGGGCCAAAACGGGGGCGAGCGGATCCACAGTGTGTAACCGCACCCCTAGTGGATCCGCCCACCCGTCCACTGCGCCACCGACCAGCC
CACTCTCGTCACCGACCGCGCTGTAAAAAGACGCGTCGCTGGCGAGACTGGATTGGCTGGCTGTGGAGCACTCGCTGTCGGTGGACAGTGAGCGCTCCCT
GATTGGCCAAAAGAACCGCATCGCTGCGATCCTATTGGTCAAAAAGGGTAAAGGGACAATGGAGGACGCAACGCGGACCGAGGAGGACAGCCGAGGAGGA
AAGGTAGGTAGAAAAGATCAAATGTAGTTGGCCTCGCGGGGGAAAGGTGAAAGCCCCCGGAAACCGTCTCGCACAGCAAGCGCCACAAGAGCCCAAAAAT
GAATGTGAAAAAGACCAACGAAAAACGTCGGAAACCAGTTTTCACACTGATTAGAACAGATACTACACTTGATCTTAGCCAAAAGGCCGAGAAGGTATGA
TTATCGTTCTAGATAGAGCTTTCTCCTTATAGTAGTTAATACCCTCACGAGCATGTGTTTGTTTAAGTATATTATTATTCTCTAATATATGGTAAAATAG
CATACCTATCCCCTACCGGTTTTTTTAAGAGTGATTCTAGCCTTCTAAGAAATTAAAATTGCGATTATAGTCTACATTTTCGGTAGCTGGGCTGAAGTGC
TGCCAAACGATGCACCGCAGCTCCTTCCTCTTTGCAGCTCGAAAGTGCTGTTCCAAAACCCCGTACGCTATCAAACTACACATTCCTATGCAGTCAGCCC
GAATGCAAGAAAGTCAACCCCTGCATCGCTCGCTAGTCGCCCGCACGGGTACCTTCCTTAATAATCACAAACCAATCAGACGCCTCGTTCCTGCCAAACA
GTTTCAAGCAGATGTCGGAGAGAGCGGAGCGACTCTCGGGCCTGCAGAATGGCGTCGTGGGCTCCATCGCCGGCATGATCGAAGTGATTCTGCAGCAGCC
TACTGTGGCCATCAAGAACGCGGTACAGCAGGGCCGCCCCATCGCGTGGTCCGCGCCAGCGCTCTACCGCGGCGTGGGCGTCTCGCTGGCATCCATTGCG
CCCGTGAGCGCCATCCAGTTCGCAGTCAACGGCCGGTTGCTGCGCGGCCTCACAGCCCGGGCG