Description :
From Genome Similarity Track
Location :
Scaffold_1:546499- 547580
Sequence
1081 bases(100 bases per row)
ccctaccaacattgtctgcgttcagcttctgtcgatcgacagaagctgcgatagcatcttgcacaaaccgtattacggcttgtcttcgctggacaaagtc
tagcgcattcgagctgaactctttcagctcgtcgccttcgtccgcagcaggccctgcctgctcgctatcatcccctatgtctgtgcccggcacagacatc
tcgcgctcgttcctgctcgaacgagacgcagctcgcgtcaccgcagctgatagtacgtcatcagctgtcctctgcggttgttcagacgcaaccgtagatc
ctcccccacttaaggaggaagctaccccgccgagcatgctcggcaaacgtggatgccgcatggcattcacgtagaacggtgtatgccctgtcgaggcatg
caccgagttgttgatggcaaactctgccatcggtaaacactcgctccaatgcgggaacgagtgtgcgtagctcttcagcgcgtcaaccagtactcggttg
acgcgttcagtctggccgtccgtctgcggatgatccgcagtcgacattgacaactgtgaaccaagaagtgtaaacacttcttgccagaaccgcactgtga
agcgtggatcacggtccgacacaatgtcgagcggcatgccatggtgtttgaacaccatgtcaacaaacagtcgcgcagtctgcgcggctgtaacagtagc
cgggacggcagcaagatggaccatcttgctgaatcggtccacaaagacaacgatgcctgtcctccgcttgttgtcgggcggaagaccgaagacaaagtcc
atggacatggactgccaacattccgacggagtcggaagtgattgaagaggagcctgcgtaaacggcgcaggcttcacgcgctggcaaacctcgcaagcac
gaacgtacttgcgtacccacttgtactggtggtgccagtagaagtcacgcgtgagaagagtgtatgtcttctcacgacccggatgccctgccgtaggggc
atcgtggtactcgaacatgattcgcagccgcagatcatgatcattcggagcgacaatgcgatccgcattgtcgtctactgc