Description :
From Genome Similarity Track
Location :
Scaffold_66:54649- 57302
Transcript NameFunction/comments
Phyci_9812conserved hypothetical protein
Phyci_230906Hypothetical protein

Sequence
2653 bases(100 bases per row)
ATGGCACGCGGCCCGAAGAAGGCGGATGGCGACCACACGCGCAAGCCCCGCAAGAAAAAAGACAAGAACGCCCCCAAGCGCGCGCTGTCGGCCTTCATGT
TCTACAGCAACGACATCCGCGAGACGGTGAAGAAGGAGAGGCCGGACCTCGCCTTCCTCGAGATCTCGAGCGAGATCGGCCGCCGCTGGAAGCAGATCTC
CGACGAGGAGCGCAGGGTACGTGCACGCTGAGTTACGCGCTGTTTGCGACGCTGTGCAGCGTTCTCTAACCGTTTTTTTTTTCTTCTTCTTTTTCGTTTG
CTGCAGCCCTACGACGAGCTGGCCGCCGCGGACAAGCGGAGATACCAGGAGGAGAAGGAGGACTACGTGCCGGACCCGTCCTTCGAGGCCACCAAGGGCT
CGCGCAAGAAGAAGGACCCGAACGCGCCCAAGCGCGCGCTGTCGGCGTACTTCTTCTTCTGCAACGACATCCGCCAGGAGGTGCGCGACGAGAACCCGAA
CAAGAAGATCACGGAGATCGCGACGCTGCTGGCCGAGAAGTGGCGCGCGCTGCCCGACAAGAAGCGCGCCAAGTACCAGAAGATGCACGAGGAGGCCAAG
GTCAAGTACCAGCAGCAGATGGACGCCTACAACGCGCACGGCTCCGCCGCCGCCGAGGAGCACGAGGAGGAGGAGCacgacgaggacgacgaccacgagg
acgacgacgacgacgacgacgacgaGTAAGCCGCGCCGTCGACGCGCTCTTCGCTCTCGTGCGCGCGGACCCCAAGCCGCCGCTGCTCGCGGTGGCGGCC
GGGACCGCCGGCGGTAGGCGGGGCGCTGCACGCCCTGTGTGGTGCGGTGCGGCGCCCCGCGGTTTCTTCTAGCTCGTAGTACGCAGGACACGCCCGGTAT
CCTCATTTATTCTTTCAAAGCTTTTGGTAACGTTCGTGCGTTTTCCCTTGCAAAATTGACACGTGCGTGGCGCCCTCTCGGTAGTCGCGCGCGGGTTTGT
CGGCCTTGAGTTGCACCCGCGGGGGAACGTCCCGCAATCGGCAAAGACTTGGCCTCGAGCACCGCCGGAAATGCGCTTAACCAGGGAGTTGCGTATGCCA
GACCTTCGGTGGCAATGAGGTGCAGCCCCCATTAGATCACTTCGCGTAGCATGCTGCATGCGCGGTGTACCAGCTGCTTCAAGTTCAAGGTGTGCTTCAA
ACAGAACGGAACACGCCATGACTGCCCGCAGCGTTACGAACGCACGGCTCAAATGTCGCGGGGGCTACACTGTAGTGTCGAGGCACCACCGGCACGAGCG
ATTGCGAGTTTCTTCTTCTATTGATGTAAATGCAGCTAGGTATCCGTCCGTGGTCTACTATAGCCCGCCTAACGCAGCAGCGCGTCAAAGTCCGGGGTCA
CCACGAGGTGGCGCTCCACGTTGCCCAGGATGCTCAGGTGCTTCTCGGTCGTGTTCACCGCGTAGACCTCCTCGCAGAACGACGGCGTCTGCGCCGCCGC
GACTTCGAACTGCTTGTCTCCGAGCACCAGCACCATCTTGCCAGACTTGTGCACGCAGATCTGAACAGCAAAAAGATGCACCATATACAAACGTTAGATC
TCGGGGCTACAGCGAAGCATCCAGGCCGAACCAAGCCGCGCCGTACCTTGCCGATGAAGCCGCCCGGCGCCGTCTCGATCGAGTGGTCAAACACACCGTC
GTCGCTGTTGTCATATCACCACAAGTTAGTCAGGCATCCTGCAAAACCAAGCCACCACCAGTGCAATTGCACGTACGCAGACTCGTCCGTCTTCTTGCTC
TCCTTCTCCCTGGCCTGCTCCTTGGGCGCGTCGGCGTCCTCCATGGACTCATCCTCGTCCGTGCTGACCGCCTTGGCGGTGGCGCTCGCCAGTGGCAGCG
TCGTCGGCATCTGGATGAAGAACAGCGAGTCGTCGGGCGCCACCAGGTCGCCGCTGGCGTCGCAGAACACCGCGCCGGCGCTCTCGGGCTCGGGCGGCCG
CACGATCGGCAGACTCATGGGCTCCATGACCGACTTGACCACGGGCGGCCACACCTCCTCCACCTCCATCTCCGGCTGCTTGCTCCCGGGCATCTCCTCG
TCGTCCAGCACGCTGATGCCAGTGCCGCCAGCCGCCGAGTAGTCCGCGGACGGCGCGGCGCGCGGCGCAGGCGTGCTGCCGCCTCCGCTGTACGACGAGC
CGCCCGAGAGCGTGCCGACGAACGCCACCTTGCCGCTGGGCAGCACGCCGCGCCCGCGCCCACGTCCGCGGCCACCGCCTCGGCCTCCTCGGCCTCCGCG
CCGTCCGAAGTCACCGCGCGAGCCTCTGTTGTCGCTCTTGAGCGCGCCGGCGCCCGTCGAGTGCGGCTTGGCATCGCGCGCGCTCTGCGGCGTTGAAGCG
GAGCCGTCGCCGCGACCTTCGGAGGCTGGCCGGCGCTTGGCGGCCTTGGGCACGAACTTGGGCCGCCGCGCGGGCGCGCTGGACGCGTCGGTGGAAGTGC
GCAGGGACCTGAGCGGGCACAGAGAGCGTTAGCGGACGAGTTGGAGCTGCGCGTGTGCAACGGAGAGAGATGGAGAGGAGGCGCACAACGCTGTGCACGT
ACGTGAGGCGCGCGCTGGACGCGTCGACGCGCGGGCGCACGGCGCCGTCGCTG