Description :
From Genome Similarity Track
Location :
Scaffold_4:546398- 547401
Transcript NameFunction/comments
Physo_128265hypothetical protein

Sequence
1003 bases(100 bases per row)
TGCAGGAGCACCTGAATATCGGGATTATCGGCGAGCCAGCTCTGGATGCAGGCGGCGTGTTGCGCGAGTGGTTCGGACTCGTGTGCAAGGAGCTCTTCAG
TGCTGAGCGTGGACTGTTCGTGACGACTCATGCGGAGGATTCGAGCTACTGGATCAACTCAGAGTCGGCCAAGTGTGTGCCTGAAGGAGAAGATCATCTG
CAGTACTTTACGTTCGCGGGAAGGCTCTTGGGCAAGGCAGTGTTGGACGGGCTTGTACTGGAAGTTAGCATGGCGTTACCACTGTTGAAGCATCTTTTGG
GCGTCCCTATCACGTTCTCCGACCTCGAATTTCTGGACGAGGAGCTTTATAAGCATCTGAGCTGGGTGCGGGACAATGACCATGTGGACGCTCTGTGTGT
GACCTTCACCATTCAGACGCCGTCGGGCGACACGGTGGAGCTCAAACCAGACGGAGAAAACATTGATGTGACTGATGAGAACAAGATGGAGTATTTATCG
CTGGTGCTGCGCTATCGGATGCTGGACAGCGTGTCTGAGCAGCTGACAGCGCTGCTCAAGGGACTATACGAGGTCATCCCCAAACCTTTGCTCACGATCT
TCGACTATCAGGAGCTGGACTTCTACCTCAGTGGGCTGCCCACACTAAATGTGACGGATTGGCAGAACAACTCGCGAGTTCGACATGCGACTACGGACGG
TGACTCTGAAGCGATCGAACAGGAGCTCGAAGTGGTGCAATGGTTCTGGGATGTCGTGGGATCCTTCACAGACGACCAGCGTGCGCGATTATTGCAGTTT
GCAACGGGCTGCTCACGTGTTCCTGTCGAGGGATTCAAGGCGCTCACAAGTGCTAGTGGCATCGTGCATCCGTTCACGCTGCAGCTGGTTCCTGTAGGAA
CACCGCCGCTGGGAATGTGTCCGCGGGCGCATACGTGCTTTAACCGGATCGACTTGCCAGTGTACGAGACCAAGGAGGATCTCAAGTCATATCTATCTCT
GGT