Description :
From Genome Similarity Track
Location :
Scaffold_33:54631- 55788
Transcript NameFunction/comments
g5182.t1POM68898.1 Hypothetical protein PHPALM_14879 [Phytophthora palmivora var. palmivora

Sequence
1157 bases(100 bases per row)
TAATGGATGTGGTTGCATGTCTTGCACTTCTTGTTCCAGACCTGGTGGGAGTGAGCCACGAAGACCTGGCAGTTGCAGGCGCGGCAAGCTCCCATCATGC
GGGACATCTCGGCCAGCACCTCCTTGCGCTCTTGGATGCCGCGCATGGCACGGTCTAGCGCTTCATAAAGCGGTCTTGCTGCCATGGGCTGACCTACGGA
TCCACTGAGCAACGCACTCGCCTCGAGGTCTTGCCCGTAGAATTTCCGGTTCAGGTCGTTGCGTGTAGCGATCACAGAGCCCTGAAGCGAGATTCCTGCG
TACAGGCCCTTGCTGATCGAGTAGCTGTAGTTACCATTGAGGCCGGAGCTGCTGATCGCTGCTGCAGCCGCAGCAGATCGCCCATAGGGCCCAAGTGCGA
TGTCCAGTCCCGCGCCCAAATTCACTTGAGGCGAGTGGAAAACCTGCACGGAAGCCGGGGAACCGAGAATGATCATGACCTCGACGATCTCTCCGCCGAT
CTCAAAGCCGCCGCCGAGCCCCACAGTGCCAATAGCTGAGGGCGCAGACCACGAGCCGTCCGGTAGTCGGGACACGACGATACCCGTGCCCACCTTCCCG
ACAACGAGGAAGCCAGCCTTGACGATCGTCATGACCGCCAAGCCGTGTGCGTTCTCGAGCATCGAAATCGGGATGGCCCTGTCCCCGGACGTGCCCGAGT
CGTTCCGGAAGAAGTTGCCAACGATATCCGCTGCGTTCGTGCACTCCTTTTCCAACGAGGGCGAGAACGGCACATGCAGCCTCGACTTGGCCTCGTGTGG
CGCCGTCTCGGCGTTGGCCTTGGCGTATCGAGCCACCAGGTCCTCCTGCAGAGGACGCAACTGAGGCGCGCAGTGCAAACACGCTCGCTGAGGGATGGAC
GGGTCGTAGCCCCTGGCGCCTTCGATCTGGTCTCCGTCCGGGATCAGCAGCAGCAGCGGCGAGCAGGTGCCACACACGAAGCGACCACAAGCACGACTGC
ATCAATAGACAGACCACACAACCGTTAATATCCACCGCAGTGTGGAAGCACTCCTCAGCAGCAGAACGTACCATTGATGACGACGTTTAGTGACGTCGAA
GGCCAAGCCGCAGATATCGCAGTTGGGGTGGTCCGAGTATCGGCCCTTGAGGACACC