Description :
From Genome Similarity Track
Location :
Scaffold_111:5463- 6937
Transcript NameFunction/comments
Albla_Nc14072060
Albla_Nc14072070

Sequence
1474 bases(100 bases per row)
AGTTTCGGTGCCGGTACCGCTTTCGTCATGAGGTTCGCTGGCATAAAACAGCTTTCCAGGTATCTAGGCTCCAATATTCCACTCTTTGTGTGTGAGCTTA
CGAACTTAATCCTGACATCGACATGCTTCGATCTGGCTGATGCGCCATCTCCTTCAAGATGTTTTGGCGCCGCCTGATTATTCTCATAGAGTACCATAGG
CTTGTTACAATTCACTTCAAACTCTGCAAGTAGCTCTCGCAGTCCAATCATTTGCATTACCACCACTGGGCCGCGGTATATTCTGCCTCCGTTGTCGATA
ATAACACACCACCTTGTTTTTTCACCAAACAGGCCACGGGCATCTCGTCCACAGTAATCCACCCTCCGGTATTCGATTTCCTGTCTGTCCGGTCAGCAGC
GAAATCAGCATCGCTGTAGCCAGTAATGTTTACCGATTCCTGAGTGAAGTTACCTTGCCTCATTTGCAGACGCAGTGTCTTACTTCCTTGGAAATATCTC
GCAATCCTTCTTGCCAGGCGCCAGTCACGTTGTGTCGGAAAATGCGTGCGTCTAGATGATCGATGTACTGCGTATGATATGTCCGGTCTGCTATAGCGAG
ATAGCCACAGCAAACTCCCCACCAAAGATTAGGAATCTTTAACTGTTATCTTTCCGTCCCGGCAAACATCCGGCATCTATTCGTCCATCAAATCGGATTC
GTTTATTTCCTCACCGATTGGGGTACGAATACCGCGTACGTCTTTCAACCCAATCTCCTTCAGCATTTCTCGGATAGTCACTCCTTGGTCAATATCGTAT
CCGGAATCATTGCTGTAAGCAATACGCATTCTCAATACATTTTTTACCTTCCCGAGATCCTTGACCGAAAGGTGCTTCAACTCACCGAAAAACGTTTTCA
CGAGAATTGACTTCGTTGCTGTCACCAGTAAGTCATCTACACCCACCACAATATTTCCTCCAAGCGCTTCCGGTACAATCACATGCCTTTAATGCATTGC
ACGAACCCCAAACTCGTTAGCTTCTTGTCAAGCAATTCGTTCCACAACCGCCCCGCTTGTTTCAACCATACAGCGCCTTCTTGAATTCTAGTGCTGTTCA
TCAACACGGCTTACTTCGAGCTTATGGAGAACATCTTGTTCAATCTCCATTCCTTTAGGTACTCGTGAAAGATGCTCAAATCCGATTATTTCCCTTCTTT
TACATATGCGTTCGGGCTGCCTACATGTTTGGCTGGTACACGCCACTTTCGAGACAGCGCTGGTATTAGCTTAACGCTTGACATATCCATCACCGCCGCA
AAAGTGATATTATAATCTCGACCGAAAGCCTGTTCGTTTCCACAGGCTACCAGCCTGGCCTTGAATCGCTTAAAAGCACCGTTTGCATCCTTTTAGTTTT
TTATACCCACTTTGAATGCAGGCTAGCTGCGCCCTAGGGTAGACGCACCATAGTCCAGACACCGTTTTCTTCCA