Description :
From Genome Similarity Track
Location :
Scaffold_1:546255- 547263
Sequence
1008 bases(100 bases per row)
tcatcacccgtagatgactcgtgctgcacgtacggcttcaaccgcccgacgtagaacgtcggatggagtctcatgctggacggtatgtccagccggtacg
cgttgccgtgccgttcaagtactttgaacggcccgatgaaccttggagcaagcttacttgctccaaaatcagacactgcatgtttaggcaggttttgagt
agctaacaaaaccaatgaaccctttttgaattcattaatgttgcccctaccaacattgtctgcgttcagcttctgtcgatcgacagaagctgcgatagca
tcttgcacaaaccgtattacggcttgtcttcgctggacaaagtctagcgcattcgagctgaactctttcagctcgtcgccttcgtccgcagcaggccctg
cctgctcgctatcatcccctatgtctgtgcccggcacagacatctcgcgctcgttcctgctcgaacgagacgcagctcgcgtcaccgcagctgatagtac
gtcatcagctgtcctctgcggttgttcagacgcaaccgtagatcctcccccacttaaggaggaagctaccccgccgagcatgctcggcaaacgtggatgc
cgcatggcattcacgtagaacggtgtatgccctgtcgaggcatgcaccgagttgttgatggcaaactctgccatcggtaaacactcgctccaatgcggga
acgagtgtgcgtagctcttcagcgcgtcaaccagtactcggttgacgcgttcagtctggccgtccgtctgcggatgatccgcagtcgacattgacaactg
tgaaccaagaagtgtaaacacttcttgccagaaccgcactgtgaagcgtggatcacggtccgacacaatgtcgagcggcatgccatggtgtttgaacacc
atgtcaacaaacagtcgcgcagtctgcgcggctgtaacagtagccgggacggcagcaagatggaccatcttgctgaatcggtccacaaagacaacgatgc
ctgtcctc