Description :
From Genome Similarity Track
Location :
Scaffold_38:54622- 61199
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_38-fgenesh-gene-0.2539S ribosomal protein L24, mitochondrial
Pytap_DAOMBR444maker-pag1_scaffold_38-fgenesh-gene-0.6Eukaryotic translation initiation factor 2 subunit beta
Pytap_DAOMBR444maker-pag1_scaffold_38-snap-gene-0.69GK16278
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_38-abinit-gene-0.124Conserved gene of unknown function

Sequence
6577 bases(100 bases per row)
GGTATTGGTAATGGAGTGTCGGGCACTGACGGCTTGAACGTGCTGTTCATTGGACGCCCAGGGTGCTGCCCACCCATAAAAGTCGGAATCGATTCAATTG
GGATGCCGTGCGACTCGAGGATCTGCAAGCATTTGTCGCTGTCTTTCTGCTCCGCATAATGAATATCAGATCATGAGTACTTGGCATTCTGGGGAACGCA
AGGACCATTAACCACTTACCAGCACTTGGATCTTGTCACGAGTTTCTGCGTCGATCATGTGAGAGATCATCTTCCACACACCCGCAAAGATCATGGGTGC
GTTGATCAGGTAAAGGCGGTGCAACGTCTCTGGGTAGTACAACTGACCAACGTCAAAGATCGGCTTCAGGTAGTTGATCACTGCACGAGACGCGTGCTTC
ATGCCGAGCCCCTTGAGGTCAACAATACAAATGTGCTTATACACACGGCGACCGAGGCGTTTGGAAATAGCAACTTTCTCCCATTGGATCCGCTCCATGT
ACTGGAGGCGGTGAGGGAGGAGCTTGTCCACCGAATTGAATTCTTTCTGGAATCCTTCGAGGTTGATCTCACTGATCCGGTCAACAGCTATGAGATGCCC
TTcACTGTCTTCGCCGTACATCATACCCGGCCAGTATTCATGGAATAGCTTGCACTGATCAAGTTCCCTCGTGAGAATCGTGTCAGCATTCATTTGGgCA
CGCCATTCGATCACGCGCTTCGCCTCGTCAAGCGTTTGCTGCAAACGCGTCTTTTTGTTATTGCGGAACGCCCTCGCGACGCGAATGTAAAAGTCGTCTG
TGCACGCATCCCCGTACTCATTCTTGAGCGCATCGTAGAAAGGCTGGTCGTCCGACGAGAGGGGCGAGGACTCGTCGTTTACCTGGGGAGTGGTCGACAT
GGCACCGAGCAGGGGAGCGAGTGAGTCCGATAAGTCGAATGCTGCAATACGACTTCAACGGCGAGGAGGCGCGTTTCCGGTGTACGTACAGGGGTCGCGA
GCACATCCTCGTGGATGCTCTGGTCGCgaGGTAGTGACTGTGTGTGTGTCAGCTAAGATCTTCTCCATGCCTCTGGGAATAGCAGATCGAAGATCACTCT
TCTTCGTATTCTTGGCTGATCATCCGACTGGGCGAGAAaGGCGACCaGAAAAGCACGTTCTGATtGGATGGACTGAGTGAATGGTCAATTCTAATTGGCC
AAAAATCGCTCAGAGCTTAGAGAAACTCACTTGATGACGCCCAACAGGGCGTGAACATGAATTGGCTTTGCGCTAAGTCGATACGCTCGTGGCTTTCTCA
TGTGCTATTCATGCATACATCCTGGGCGGTTGCGTTATATGCAGTGATTGTAAGGCTCCACTACGGTAGGACGGCTTTGAATGAGAGCGATGGAGTGGAT
GAGAAAACAAGGTGAACACTAGGAGTTGGATCCAACGACTCGACACTCGATCTGTTGATTAGACAGGACAAATGCTTCACGCCAGACACTGTCTGCCTCT
CTATGGAATCTACGCACGAGTGACTTCCCAGTCCTCGACCGTGCGCTCGAGCACATCCTCTGGAGCAGTGTCGAATGGACCAGTTTCTGAAACAGGCATA
GATAACGAGTTAGCTCTCTTAAACCTCTGAACTTGGCGACTTCGAATCAGGAAGAGAGACGCACCTGTTCGTCGTGGCGTGTGGCGCTCCTTGAGAACGT
CTGGCTTCGGGATGATCGTGCCAGTCTTCTTGGAGACGCGGACCTTGTCACCATCATCCGTGAAGCGAATGGCAACACGCGTTGGCTTGCCAATCGACGG
GTCGACGAGGTTGACGTTGCTGTAGTGGACTGGTCCAGGCGCCAAGTACGAGCGGCCAGGGGCAGCAGGCGTTGACTTGACATAGCGGTTGTGCTGCATC
AACACAAACAAAGATCATGAGTCCAGCAATTCAGCAGCACAACTCTGTCGACTCTGCAAGCGCACCATGTTGATGTTCTCGACAATGACCTTGTTCTGGT
CACGGATCACCTGGACCACCTGGCCCTGCTTGCCCTTGTGTGGACCATTGATGATCTCGACCTGTGCATCACCATATCGCTTGTCAATGCTGTACTATTC
GGCGTACGCTACTCGCGACAACGCACCAAGTCACCGCGATAAATATGCCAGTTCTTGATCAGCTCAATGGCCTTGGTCTTTCGGCGCGGGCCCTGCAGAA
ACGCCAACGGAATACGCGCCGCCATGATGCTCGTCGGAACTCTTCCACCACCACAATTTAGAGCAGCTCCCGAGCGGCcGTGCCAGTCGCTCGTGCAAAC
GAACTTACTGAAACACCTCAAAaCCTCATCCGAGATCAACCATGCGAACCTAAATCCCAGAATATGGGTACGGGTCAACCCATCAAGTGCGTGATCTTGA
CCCGGGTCGAGGGATGTTGACCCAATGCCGGCGCAGAGCCACCAGAACCTTCAGGGGATTGGACCAGGGAGAAGAGAAGCGGAAGATGGCGGACGAGATC
AAGGACGTGAGCGTGGTGGAAGGCGAGGCCGTGGCGCCGCCGCCAGTGCCAGAGGATGTGGCGTCGATGTTCGATCTGACGAAGAAGAAGAAGTCGAAGA
AGCCGAAGGGAGACAAGGAGAAGAAGTCGAAGAAGAAGGACAAGGACACCGAGGGCGGTGACGCCGAAGAGGATGGCGCAGCGGCCGCTACGACGACCAC
GGCTGGTGCCGGTGGCGTGCTGGTGCAGGACCCCGCGACGTACTCGTACAAGGATGAGCTACTCGCGCGTATCATGTCCAAGCTCCACGAGAACAACCCG
GAGCTGTCGGACCGCAAGCGTCACACGATGAAGCCACCGCAGGTCATGCGAGGTGCGTTAATACGGCTGGATGAAAGGGAGGGgATAGGTTGGAAAGGAG
AGAATACTGATGCAGATGCTTGACGTGAAACAGTGGGTACCAAGAAGACGCTGTGGGTCAACTTCCCGGAGATTTGTCAGATGATGAACCGTAACCCAGA
GCACGTGCTGCAGTTCACGCTGGCCGAACTTGGTACGGAAGgTTCGATCGACGGTAGCCAGCGTCTCGTGATCCGTGGTCGCTTCGTGCCCAAGTACATC
GAGTCGCTGCTCCGTAAGTACATTACGGAGTATGTGACGTGCCAGATGTGTCGCTCGCCCAACACGACGCTCACGCGAGACAGCGTCAGCAGATTATACT
TCGTGCACTGCCAAGAGTGCGGCTCGTCGCGCTCTGTGTCGGCCATTCGCACGGGTTTCCACGCCGCCACGCGTGCCGACCGTAGAGCTGCGCGTAAGTA
AGTGGTGCAAACCACCGACTGACGGACATCAGCAGGAACGTAGTAGAGAAAGCAGTGCATACGCTCGATGTTTGCTACTGCTCCAATCAAGCCCCCCGcA
TTGTCGGTGGGGCAGCAGTGCGCCTCGAACGTAGGCTCAGTATATGCTAATGAGATGTGGAGGTGAGAAACGCAAGCAAGTGGGTGTCTATGGTATGACG
ATGTCTATGATCTCTTGGCCTTTTTGCCGCTCTTCTGGTTGCTCACTGGGGCACTTCGCTTGTTCGTGCCCTTGCGCGAGATGGTGATATGGCGCTCGAG
GCCTTCGCCGACGCTCACGTGATCCAGCCCAAGTCGCTCGGCACAATCGTGAGCCAAAAGACGCTCGAATCCGTTCAAGTTCGGGTCGAGATGAAGTACT
TCAGTGCTGTCACTAGCTTCGTACGCCTCGATCTTCTTAACCAGTGAATGCGTGCTACCAGTCGAGATGCCAGGCTTGGTCTGTTGAGTAGGTCGCGTTC
GAACTGAGGGAGCAGTCGTCGATGGGGCGGCACGCTGCTGCTTCTGCACTGGCTGCCGAATGTCTTCATCCTCGCTCTCCTCACTGCTGCCGCTACTGTC
GGAAGATGTGGATGCCTTTCGCTTCGAGACAGTGACTGTGGGCTTGGGAGTTGGCTTCTCATCCTCGTCATCTGAATCTGACGACGACTCGGATGAGAGT
TCCATGGTGGGCGCAGGAGTCGAGTGAACTGTCGTCTTTGACACGGACGAAGTCGCAGGAACAGCTGGGCGTTCATCTTCAAAATCGTCATCGCTCGACT
CGGAACTGACATCTTCTGATGCTTGGGTGACGCTCTTCACCTTTGCCGCAACTGACGCAGCGGCAGCCGACACAATCGACTGCTTGACTTCGTCCACGCT
GTCATCATCATCGTCGTCAGCCGCCGGTTCTTCATCTTCGTCATCGGATGACTCCGACTCGCTCGACACTTCCATCTTAGGCACACTATCAACGTAAGCT
TGCTGCATCtGTTCAGGCGCCGACCGGATGCTCGCCATTGCAGCTGCGGCCGAGAATGAGTCGTTCTCTTCCTCATCCTCGCTCTCCGATTCGGAGCTCG
ACGCATCGTTGGCCGTTTGCTGAGGTGGAGTTGGCAGTGGCTTCTCGTCATCGCTGCCCTCTTCATCAGACGACGACTCGGACTCGCTCGAGATGTCGAA
CTGGGGTACACTCTCGACATACGCGGCGACAGGAGCGGCTTCGACCACCTTCTCGCGCTTCTCCTGTTTGGCTACCGTTAGAGCTGGGACTGGGGTGGTG
TCCAATGCAGAACGCGTGTGCTTTCGCAGACTCTTGAACTGATGTACGGACGCATCGCACGAGGAGCAGTACGCTAGTTCACAGTCCTCACACTGCACTG
CAGCTTCTCGCTTCTCACACTCCCCACACTTTGGTCGTGTCACAATTGGAGGCAGCGTGTCCAGCGTGTGCGATCGCATGACCTTAGGGCGATGCACAAG
CGTGCTGCATTCTTCACAGTACATGGCGTTGTCGCAGCGCGCGCAAAGCAATGACGCGACACCAGGCTTCTCACACTCGATGCACGTTCGATCCGACGAC
GGAGCTGTCGGAATGGACACCGTCTTCTTCTGTGACACCGGTGCAGCATTCGTCTTCTTCTCCTTCTTCTCTTTCTTCTCTGCTACAGCAGGTGCCGCCT
GCACTGGCTTGCTCTCATGCAGGTAAGCACACTGTTCGCCGCGGGCACAACGTCCAGATGCAAAGAAAGCACACGGCACCGGTTTGGACGCAGGTGGAAG
TGCTGGTTTATCAGTGTGAAGGAACGCACATCCGTCGCCCTTGGTACATTTGCCTGCCGCGTAGAACGAACACTGCGCTGGGATACTCGCGGGCGCTGGT
GGTGGCAATGGACCAGCCCCCAGTACATGTGCATAGCGGCACGCCTCGCCTTGCACACACTTGCCCTTGGCGAAGTTGCGGCAGATGGACTCCTTCGGGA
TGCCGCTGATGTCGTCGCCCTGGGCACTCGCACGTGCCGTGTTACTCTGCTTCGATGAGTGAACaGTAGGTGgCACACGTACTGCCGCAACAGgCgCAGC
CTCTCCATCCGTGGGATGCCAATATCTAACCACACACAGACAAGTCAGGAGTCCATCCAGAGCTGCTCTCTCATCACTGCACATACTTGCAGGCGTCGCC
CTTCCGGCACTTGCCCTCCTGGAAGCCACGGCACGGGCGCGTGGTCTTACTGAACGTGCGCACATGCTGCGCCTTGATGGCGTGGCCCTCAACCACCGCG
CCATTCATAGCCGTCGCGGCGCGTTGAGCCGCCCGCGTCGACGCGAAGACGACGTGCGCGCCGCCTCGGCTATCGATCTTGATGCGCTGCACCTGACCAT
AGGCACTGAAGAGTGTGCTGAGCGTAGCTTCATTCACAGCCGGCGCCAGGCCCTTGAGCGCCACAGCCGTCTCCTTCGTGTCCATCGGCATGATGGTCGA
GTCAATATTtGTTGGTGGGCAACACCAATGGACGTCAACTATGTGATATCAGAGGGGAATGATCAGGTAACGAAGGTTTGCGCGCAGACGGAACCGCCCA
AAGCCAAAATGGCGCCCAAGAGGAAGCGGATGGGCGCGGCGCGCAGGGCGATGGAGGCGGAAGCAGAAGAGAAGAAGAGTGGAGAGGCCGATGGATTCAT
AGCGCGTGAGAAGAGCTATGCGGAGATGGTCGAATGCCATTCTGAGGCCGCGGGAAAGACGAGTGAAGAGCCCGTAAAGGACGCAGCCTATGAAAATGGC
GAGAGGGAAGGAGTCGTTCATGGGGCGGAGAAGACGGATGGAAGAGAGGAAAAaGaGGAGGAATTAGAAGTGAAAGACCTAAAGGATGGCACGGAACAGT
CGATACGACAAGCACACGTTGCAGAAGAGGAGGAGCCGGACGAGGAAGAGACCCTGGTGGTGCTGGAACTCGCTGACTTCAAGAACCACCCCATTCTGGA
CGACTACAGGAGCATCGCGATCGAGGTACGCATGTGCGCGTGAGTATTAGTACGCAGGCGAGCCAGCTGATGCTCAAATGTATCATAGGGCATTGATACA
GCTCAGCCAACGCTGCATATCGGAGAGTACTCGCTTCATGGGCAGATGGAGGAGACCGTGGGGACGCACTACTTCTACGATACGAAGAACCGCGCGGACG
GGAATGCGTACCGATACACAGgCCAAACGACCAAGAAGATCAAGTTCACGATCGcACCCCCcGATGAGTTCTGAAGC