Description :
From Genome Similarity Track
Location :
contig_121:54615- 59146
Transcript NameFunction/comments
g13437.t1RAW33967.1 Large subunit GTPase 1 [Phytophthora cactorum
g13438.t1hypothetical protein

Sequence
4531 bases(100 bases per row)
ACCGGTAGAACAGCGGGTTGCGGGCATCCACGATCTGCACCATGATATCGCTTCGTTCCCGAACGTGCCACAGCTGACGCCACACCTCCAGGTTCTTCTC
GAACGGGGTCACCTCTAGGTGCTCAGACGACGCCTCCAGCCTACGCCACGACAGCAAAAAATGAGTCAACTGGACTCTTCACGCGTATGCAGCACCCCTA
CTCACAAGGCAATATCACGACGCCACGTCAGGAAGCTCTCCTTCTCCAGTCGGTTGAGCTCGTCGGCCGTCGTGGACGCGTCCCAATTCGGGCGACGCGG
CACCTTCATCTCCGCGAACGTCATCTCCGGAGCCACGTTCTTCTCCTTCCTGCAGTCGGCAAATTAGTGAGCTACCCCACCACTCAATTGCAGCACCTCT
GTCTAGCTGCACGCACTCAATCAGCTGCGGACCGGCGTCCGCCTCCTCCAGGAGCATGATACTCTCCTTCACGGCGGTGAACTCACGGTTGGCCAGCACG
GCGCTGGCCAGGAAATCATCCTGCAATTACAGTAGCAATAGTAGAATAGTGAGACCATTGGCCACCAAGTTTCTCGCTACGTGTTGCATACCAGGGACGA
GCCTTCCAGGTACGAGGCCAACGCCACGGACGCGTCGCCGCCATCGCGCTCGGACACGTGCTTGCCGGCACTGGACGCCACGTCCTTCGTGTTGATGGCC
GACGTCTTCTTCTGCGTGCGCAGCAGGGCGTTGCCCAGCCCGCCCTTCTTGACCTTCTGCCCCGTGCGACCCATTGCTACAGCTTGTTCTTCTGACGCTA
ATCAATGGACCGGAAAAGTGGTGTGGTGTACATAATCCAATGTAGCCATGTCTCACTTCAACATGGACGTCCTGTTGCTCTCGTTGCCTTTGACGACCGA
CAGGACGACGCATGTGCAGAGCACCACCCACTTGAAGCGATTTATCTGCATTGAGCCATTGGCACTAGCAAGCAGCGTTTGCAATCTGTCGCAAGAATAG
TGGTTGTTGATTGAAGAGTCGCTGAGTTTCTCGGTGGTGAACTGCCGCCGGCGGACTATGGAGGATGGAGAGCACTCGGATGTGACGCTCACACTACGAG
GAGAAAGGATCCCGCTCCGGAATGCTGTTTCGTCCGTGTACAACCGCTCTCACCAGGAGCTGCTGGTCGCTACCCCGACGGCCCTCTACTTGTACGGTAA
GATGCTCACTGCGGGCGGCGACCTGCTTGCGACGCTAGCGGCGGAGGAGAACGTGTACTACCAGTTCGCTATTCATCTTCCTTGGGTACGTGACTTGCTG
CGGATGTATGGAGGAAATTTGCTTAGGTTGGTTGGTGTTGCTCTCTGAAGCTGGATGCCTACTCGGTCATTGTCACGAATGCAAGCGGGGGGATTGAGCA
CCGAATTGTCAGGTGAGGCAAGAAGGCCTTGCTACTGTAGCTTGTATCACTAACACGCTGGCTGGCGTGGTGCAGCTCAGACCTCAAGACGTCGCTGACG
TCGCACACGCTCCTGGAGAAGGCGGTCAGTTTTACACGGCGCTGGCGAATCCCCATCGACGAGAGCTTATCACTGCAGACACAGACGGAGGAATAAAAGT
GTGGGCGCTGCGCGTGATTGCCACTACACAAAACAACGGAGGGTTCAAGGGGGTTCTGCGTGTACACACAGCTGCGAATTCGGTGCGTCAAATGCCACTT
TTTAGTATTCCCTTCACGCCATTAACATTAGTTTCGTTTCGGTTCGACTCCGAGCAGACGAAGAAGCCGTACTATCGCCACCTACGCATGAGCTTTGATG
GACAACGAGTTTTTGCTGCAACCAGCTCAAAAGTTTGTGTGTTTGATGCGGCGTCGTGCAGTCGTTTGTCATGTTGCCTGAGCGAGGATCGACGCGCCAT
ATTCAGTATGGAGTGTGGCACCGAAGATAACAGCGTGCATCTCGTGTTCAGGCTCAACATGAGGTAATACTACGCATATACCCACGTACATGTGAGGTAC
AGACTGACAGCTTGACTATGAACCAGGAAAATCTGCAAATACTCATTCGTCGTGAAGAAAGGAGTGCCGCAGTTTCGAAGAGTGGGTGAGTACGAGCATG
ACCAAGACCTCGCTGTGTTCATTGAAAACTCTCGGCGTCATTGGATTCTGAGAACGGGGTCGTGATGGTCGATATCTGTGCGAGGTTTATGACCACTAAC
CTAATCGATTCAAGGCAAGTTGGCGCTGGCAGTTCGAGACACGGTCGGTCCGCCGTAACTTTACCGTTCAACCCACCGTCAGAGCGATACAATGCACTTC
ATGCAGACATCGTACCTGACGGCCGGAACTTTGCCTTCGCTGTGTGGTCGACCGGCTTTTGCATCATGGAAATGGTTTTCGCGGACGACCAAGGACGCCT
TGTCTGCGATTCGTTCAGCGGCGAACGTCTTAAAAGACTCAACGGTGTAGAAGAAAGCGGCACCATTTCTATTTACCAGCGACTGCCTTCGGCGCAAGTG
GCGATGTTCAAGGAGGGAGATCCCCATTTTCGTTTCGCGTCACTGCCAACTGTGGTGGATTCAAACAGTACAGAGGAAGGAACCACCCTTCCCATTATTG
ACTATGTCGTGGCAGCAGATGCCATCGTGGCGTTATGGCCTCACGGGTTGGTGGAGAAGCATAATTTGTCGGACAATCGGTTTTTCAGGATTGCACAACC
TTTTGAATCTGCAGCGACAACTGCATGCACGATGGTAAACCTGTACTTTGACTATCAGGCGTGTGTTGCTGTCGGTGACTCAGGCGGGACTATATGCATT
TTCCCTTTGGGAAACAACGACACAGAAGCGCACAGTCTGATCACCCGGAAGCAAGCATATACGAACGACAGGTGAGCATTTTATTGATTTGGCTTTTTTC
TTAATCACGATACTTTACTGACCTGTTGTTGCCTTGTATCTTGGCCACCAGTGTGACCGTATTGATTGATCTTGCCACCACGGAAGTTGGTTCCTCGCTT
CTTTCTGTTAGTCGAAATGGAGAAGTCAAGCATTGGCTTATAAAGAGACCGACCACTCCTGATCAAAGTATTGTCTGGGAACTACTAGCGTGCTTCCGAA
CCTACTCGCCTGATGTTTCAGTAGCAACGTTTGAATCTCCCGAGTTCTTGTTTTGTGGGTTTGACGGCGGAAGCGTCGAGTGCTGGAGGTTCCCGTTTGG
TCCGGATAAATCCTCGTCAAACGGCTCACGACTTCAGCAACAAGCTACACATCGCATTTCAGTTGTAAAGCGGGCCTTACACATCATCGATTTGCACTTG
GCGCCAGTACTCAGCATTCTAAGCGAGTCAGGAGCTGGAGTGGCAGTCACTGCCAGCCCACAACCCGTGTCTGACAGCTTCTCGTGGGTCTTTTCGTACG
ACGAAGATGCGATTATTCTCGTTTGGTGCTTTTCTCTCGACTTCTTCTTTCCACACCGGCGGATTAAGGTCCATGAGTTCATCAAAGGTATCTACATCTC
GCCATCCAACGGGTAGGTCCTGTGGTATAATGCGTGCATGTGAGTACTCGTAGCGACTAATTTGTGTTTATTTTGCTTAGTTTCTTGGACCTCTTCGCGT
ACATTGATCGCTGTATCGATCGGGTTGATCACCTCGGGTCCGGTGACAAGGAGGCTGTGAGACTCCGTCTTCGACGAGGACGAGAACTCTCTGCTCAACG
TGACTTGAAGAGCCTTGAGAGCGGCAGTAACCAAGCCACACTGACAACGGGACGTCGTCGCGGCAGTACTCGGACAGGCCAGAGATCAAGTTTATCCACA
CCGGAGTCTTATAATCGAAGCCGATTCATGACGGCTAGTGTTCCGTCTGTTCGGATCAACATCACACTACCCGCAGTCGAGCAGAAAGTGAATGCAGTGC
GCAAGGCATATGCCGAAGCTTCTCCAGCGAAACCTGTTGCTGAAGAGCCCAAACAAATCCAGACTCCTTCTACCGACAAGCACCTCGATGGAAAAGACTC
ACCCGGTGAAGTAAGTATTTTGCAAAACGTTCTGAGCTCGTCTCCGACTCGGATACTGGAACGGCCACCGCCAAAACCCAGAGCACGATCTCCAATGTCG
CGCCGAAGTTCCTCACGCCACTCATCCCAATCACCTCGACGTAACAAACGCAGCAAAACGAAACCCCATACACGCAGCACTGTGCGCGACGCTAAAGCCA
ACTATCTGCCAGGAGAGAATTCGCTTCCGAGCAGTTTTCAGCAAGCCAAGCCTCGCATCTATCGGAAGGCTGTCAATCCGTTGGATTCACTTGCATCACA
AGCTCGCTGCGCTGTTATTACTGCTGGAAATGCATCACCATCGTCGTCGCCCTCCTCCTCTGATGAGGAGGACGACTCTGAACTCCCCGATACAGTTGAT
ATCCCGAGGAGTCGTGCGAGTCCAACTAGTGCGACCACGCTTGAGCTCGGTCCGCAGGAGAAAGTCTCAGTGGTTTCACTTGTGGAAGACGAAGATGAGT
CGATCTTGTTGCTGGATTTTCGACCAGGAAC