Description :
From Genome Similarity Track
Location :
Scaffold_70:54610- 55844
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_70-fgenesh-gene-0.9Flagellar associated protein
Pytap_DAOMBR444maker-pag1_scaffold_70-snap-gene-0.48Gene of unknown function

Sequence
1234 bases(100 bases per row)
TGGGGCCAAGCTGCTGTCTGGGTCACATGCTTCAACAaTATGCCGGGATCTTTCTCTGAcACCTTGGCGTCTCGAGCAACTGGGCTGCCTCCGGTCTTGC
TGCCCATGCAGGCGACTGTAGTTGGCTCACCACTGACGCTTGATACCAACTGCGTGGGTCTGCAGCAGCCCAAACGAGCATCGATGgCGTCATTTTCATT
TGGACACGTGTGCGTGCGCTCTCCTGCgaTCACGAAGACGCTTCGAGTGCTCAATCGTGGACCGAAAGCTGCCAGGGTCAAGTGGAAGCTCGTCGATCCT
GCCAAGGAAGACCAAGTTGTTCAAGTTTCTCTGCGTGTCGACTTCTCCGCTCGagTGCAGCTTCGAATCACGCCACTGGGTGACAACGATCGCGAGTTTC
CATTCGAGATTGTGCCTCCACACGCGATGGTCgaGCCTTTTTCGACTGgCtCATtCAaCGTCACGTTCTTCCCATCTACGAGCCCTTCGTTtCCACGAGT
GCTTCTCGTCGCCGACGCACaTTGGATCGACGCCACtCcATCTCCATCAACTGTGTCGCTGGATCACATCGAGAACCCAGCTGATGGTGCACCCGTGGTA
GATGAAGTGACCGACTCGCGCTGCGAGTCTCCATCTCCCAGCATCGCTCCCCCAACGTCTGCTCGACTTGCAACTGCTGCCGGgAAGgCCATCCAAGCGG
TTCGCGTCGCCAACTCCATGTATCGCAGTAGCACTCCaCACCCCTCGACAGCGATGGCTTTGtCATCGGCGACTTTGAAATGCATTCGAGTGTTATTATG
TGCTGACGTCGTGGAACCTGAGCTCTTCCTGGATCAGCCACGACACAACGTAGTCTCGCCTCCACCGTTCCACATCAAATTCACCACCTGGTCCACGCTG
CTCTCGTCTTCGAACACCAACCATGACTTCCACCGACGAGAACTCTCACTCATCAACCATCTCAATGCCCGCGTGACCTTCCGGCTCGAGTGTCAAGGGC
CGTTTGCCGTCGTGCGAGCCGAGTCGCTCGCTCCAAAGCATCCGCTCGCGACGAGCGATCTCCCTCCTGCACACCGTCGAGCTATTGGCGAGTCCTTCCT
GTTCACTTTGCCCCCGCAGATGTCGGTGCGGATTGAGATTCGCgCAGATCCCTCCgAGATTTCAGTCCCAGAGACATCCAAAGACCGACTCACGACACGC
GTCACGGGCGAGTTACTGGTGCGaTTCACAAACC