Description :
From Genome Similarity Track
Location :
Scaffold_34:54605- 56004
Sequence
1399 bases(100 bases per row)
AACAGTAGAGAAAGCGATACTAACTCTTCTACAGACTCAGATCTCCATTATAATCTGTTCGTGGGGTGACCCATTCGGATCGTGACTCGGCACTCCACGT
TGGCCTTGCAATCAAATCGTCCGACCTACAAGGAAGTATGGGATAGTGGACATTCCTGCTCTCGCCGTGGACGTTGGAGACTGCGAAGTATTCGAAAGGA
GAAGTTGAGATCCTGGGAGTTCTTGCTGCAAGTATTACACTTAGATCCCAGGTGAACAAATTTCTAAAAAGGATCGCACCAAGAAAGGATCGCAAGTGTC
CTACACAGACTCGAATCCCGATGGTAAGACGGGATGAAGTTCTGTACGTGGTAAGTTTCGATTAATCTGCTCATTTAAAGCATGCTTACAGTACGACCCT
GTGGAGGCTACCTCAGTGGGCAGTGGTGAAAGATAGAGCCGCCTATGCCGAAGGCCTCATGGTCTATGAGGCAGAGTGACATGAGCTCTGGTTGGCCAAA
TCCGCTAAGTGAGATTAATCAGAAACAATTGGTGATCTCTGGAGATTCGAACATAGCGATCAGGCATGTACGAGGTGAGCTCAACTGCGAGGTACCTGGA
TTGACGTTGCTAAGGATGAAGGTATTGAATCGAGTACAAAAGCGATCCGATAACGATTTGGTACATGTCAAGCAGGACCGGAACTCCAGTGCAGACAGCG
TAGCGAGTCTGGTGCTACAAACCAAAGTGGGATTGACGTAGAAGAGGTTTCCTACTGTCAAGGTCTCAATGGCTCGACCTGGCAATCCAACAGCGCAGAT
CTCTGCCGTAACCACTCGAGCTAAAGCAAGGCCGACATCTATATCCCAGAATTGACAAGAAGAATTTGAGAGAGGACTTCGAAATGATCGGATCCGGAGG
GCACATGACGAGGAGGAATGGATCTCGATACCAAATCCTATAGTTTTGTAGCTGCTGATTACGAGGCTAATCTGAATAATCTGCTCTTCTACTGTCCATC
GACGAAGCGTACTGACGAAGAGCGCGATGGATTGATCTGATTGATACTACCAGAAGCTTTGCGTCAGTATATCCTACCTCAATATCATTCCGGTTTCGAG
GGTAGACACTAGTCACACGGCCGCACATATCAGAGAAGGAGAGATCGGTTCTCCTGGAGTTGGCTGTACAATTGCATGCAGCGGTATGACGGTGAATGCG
TGGATTGAGACGGCCAAAGGGCGACCCATGCTCTCGGGCGAAACGAAAGGGAATGTCTAAGCAACGTGTCCTTCCGAGATCATCGCCATGAACCATATCC
CTTCGTTATCCAGGTTCTACAAAGGTTGTTGTTCTGGCTATATCTGTTCAAGGAGTATATGAATGCGAAAGCCAATGAATCCATATTAACTCAGATTAT