Description :
From Genome Similarity Track
Location :
Scaffold_532:5460- 7266
Sequence
1806 bases(100 bases per row)
AAGTGACCTCCAGCCGAGGATCGCAGCAGCACCCAAGCTCAGAAGCGCGTGAAGATGTGTGGAGGAAAGAGTGCTAAGGCTGCTGAAACGAGTAGCTACG
CTAATGAAAGTGATGACAGTTATTCTTCAAGTGATGAAAATGAAAAAGCCGGTCGCAGACAAAGCCCATGATAACTGGTACCTGGACTCTGGTGCATCGA
GTCATATTTCGAACCAGCTCACTGATTTCATGGAGTTCACGCCTCTTAGCGCCCGGATTCGAGTTGGAGGAAAGAACTCGCTGGGTGTTGAGGGTAGAGG
TACTGTGGTTAAGGAACTCGAGACTACTGGTGGGAGGTGCTCACTGACGCTGCGAGGAGTTCGTTATGCTCCAGAGCTGCAGTGCAGTCTCTACTCTGTG
CGACGGCAACTGAACCAATATCTGCCTGAACGTGATCGTGTGAACGTGCACTTTGATGAGGCAGATCGCGCTGATGTTATCTTACAGGCTGGTGTGACTA
CCGCTCGAGTTGATTATACCAATCTCTATCGCTTGAAGTTGGAGAGACCCCAAGAGGTAGCCATGGTGGCGCTACCAGCTCGAGTGAGTAGTTTGGAGCT
GTGGCATTCGAGATTGGGGCACCCTGGCAGATACTCGTTTAATGCGCTGTTCTGCCATGATCAGTGGCCGTTGCCACATATGAACTTGCGTATCCCGGTG
GGTTTCAATTGCGAGACCTGTGGGACGGGGAAACTTACGAGGAAGAGCATGAAGAAGTCTCGGACACAGACCCGCGAGTGGTTAGTTGGCGCAAAGGTCC
ATGTGGACGCTTGGGGTCCGTATGTAGAGCACTCCTACGGTGGTAAACGGTACTTTGCCGTGTTCGTTGATGATGCGAGTCGGTTTGTCACCGTGTATCT
TCTGGAGCATCGTTCGGAAGTGTACCAGAAGTTTGAGGAGTACTATCAACGCGTCAAGACGTAGCAGCATGTCAGAATGAAAGCGCTAAGGTCAGACAAT
GCAAAGGAGTTCAAGAAGCTGCAAAGTACGTGTGAGACGAAGTATGGTATGGAGTTTGACAGCAGCATCAAGCATACTCCGGAGCAAAATGGTGTCGCGG
GGAGAATGGTCCGCACCATTACGGAAAGAATGCGATGCATGCTCGTGCACTTCGACCTGCCTGAAGCGATGTGGGGTGAGGCAGCGATGACAGCTGCATA
CTCCGTGAATATTATGCCAAGCTCGGTTCGAGGCATGGAGGTACCGTATGCAGTATGGCACCGTCAGACTCCTGCTTATGAGAAGTTGCGGACGTTCGGC
TGCGCCGTCCTGTCGTACATCGACAAGGTGGAGAGACGGAAGATGCAGGCGAAAGCATGGGAGGCGGTCTTCGTTGGATATTCGCGAGAGAAGCGAGGCT
ATCGCTTGCTCGATAGCAAGACCAACAAGGCCTTCTACAGCCATACTGTCGTGTTCTATGAGAATAAAGCTGGTCGATTGCTCATGGACTCGGCATCAAC
GCCAAGTGCAGCCTCCGGTAAGGAATATTTAGGCGTTGATCGATCAGTAGAGGATGACATTGAGCCAATGCTGGATGAAATGCATGATGAATCAAATGAT
GGAGGTAGTTATCGTGATGATGGAGATTGCTGGACTGGTGGGGCCAGCGACTCCAGAGACGGAGGTGATTATCGGACTGGTGGGGCTGATGACACCCGAT
GTGATGACCGACCAGGTGGGGCGGTTGAGCAAGATGTCCGGTCAGGTGGGGCATGTGGGTCCAAGAAGAGAGGCCCCGGTGGTGATGCCGCAGCGCCTCG
ACCAAA