Description :
From Genome Similarity Track
Location :
Scaffold_938:546- 7492
Sequence
6946 bases(100 bases per row)
CCTTCCTACTCTTCTTCATAAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCTCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAGTACACCAGAAATTCGCGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGT
GATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCAAAATCCACCCGGTCGGACTCATTCACT
GAAAGACGGATCTCAGGCCTGTGCTGATATTACCTGACCCGTTTCAGCTTGAATACGTGTACTACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCA
ACTTAACGGCGTGTTCCCCTATCTTTTCGCTCACCCGGAACGGTCCGTGCCATGGATGGGCCAGTTTACGGGCGTACCTTCCTTCACCCGATCTAAATAA
AGCCACACCTGCGATCCCACTTGGATTTGATGGGGACGAGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTTCGTAGCCGTTCGTTCACTT
GGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGCAATGGCCGCTTCTAG
GGTAGATTTAGGATTCCACCCATTTACCAAGTAAAATGGGGTGTCACCCCGGATCCTTTCCTGTGCGATATTCATTGCGGAGGTGAGTCGCTCTGCGTAT
TCATCCCAATCCCTCTGACCCAAGTCTTGAACATACATCTTGAGCGCCTTAGTGATCGTCTGTACCATGCGCTCGGCTGATCCATTGGCTTGGGGACGAT
ATGCCATGGTTGCTCGCTGTCTTTGCCCCAGGATCCGGTTGAAGGCTCGAAAGAAATCGGACATAAAGCCTGGCTCCCGATCATGCCGAATCAACTCACT
AGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGA
TCCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGATAAGTCGCTTGGACAT
TCCCAGGTGACTCCCATTCGGTTGTGGGCCTGCCCTTGCCTGTCTGACAATCCACACATTCACCGATATATCGTTGTACGCTCTTGAATATCCCCTCCAG
TGGAACCATTCCCGGATCCGTTGGTAGGTCCGACCAATTCCCTGATGTCCACCTTCTAAAGTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTT
CCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACCCTTTTCGTAGGGGGACAATAGAAGAGCAAATCATTCAGGACTACTGCATAATCCGT
AGCGATAATACTGTAGGATTTGGCATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGAAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTCTGAGG
ATCCGCTCGATGCAGACTCCCTTCACAAACGCTTCCTCTAGGATCTTGGGGCTGGATCCAACCTTTCCTCTGGATCTAGTGACATCCATAGCCTGTACCG
TCCGCTTCACGGATCCAGCCACCATAACTTCGTCTAGTCGGTTTAGTGTGACGAGACCCTGACGCTCGGCCTCTCTCTCCACCTCAACCCCACATTGATT
CCGTAAAGCAGCACTGGCCAAACTATCTGCACTGGCATTCCAATCCCGCTTGACATGCACCAACTCGTGATTCATCCAACCACACAGGTGGACCATCACT
TTCTGCCATAACAGTGTTAGGGCCGGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTC
GGATCCTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGTCCGCTATACTCCGCTTCATTGACGGTGAGGCCCTCCGCACAAGTGGATCTGGCCCTTACCG
CTTCCCATCCGGGCAATTTCCACAGTATGGCGCTGTATGCTCCTCCTCCGCGTCGTATGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTTATC
CACTCGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCGTCCATCTTGGCTCTAGGTGTGATA
CTCGCGGCCAAAACTCCCAGGATCTCGTCCTCCCCCTTCGAACATTTCACAATCTCCAGTGTCCAAGGGGAGGGTAGCGCTGCCCATTGTCCCAACCGTC
CTTGTAGACCGGCCGACTTGAACAGCCAAGCGAGCGTAGAGTGTCGAGTCAAGATCCGGATGGATCTTCCCACCAGCAGGTTATAATTGAGATCCAACAT
CCGTAGGGGTGCGAATATTATCTTCTCCACCGCTCCGTAATGCATCTCATTCGGCTTTAGCGTTCGGCTGACGAAGGTGACCGGATGGCAGATCCCCTCA
TGTTCTTGTACCAAAGCTGACGAGAGCGCCCAATCACTAGCATAGACTATCATCGTAGGGTGACGCTCCGGATCAAAATGGCGGAGGATGGGCGTCGACG
CGATCCTGTTCCTTAACCCCACGAACGCGTGCTGAGCTCGGATCCACCGAGGCCCCACCTTTTTCGAGCTCCCCTCCGTCAGCTTCCTCCAGATTGGACC
CTCTCCCCGTTGGTCCCGGGATGGATCCAGCTCCTGTTTTAGGTAGTCTTCCGGCGTCGTACTACGTGAGTCCCCTCGTGGATCTGGGATCGCTAGGACC
AGAGCTTGTTGAATCTTGATCCGGACAGCCGAAGTGGCCATCGCAGCAAAATCCACCCCCCTCAACTCATAGAGGACCGCAGCAAAAGTGCATTATCCTC
AATGAACCGACTGTAGTAGTTCGAGCTGCCCAAGAAGGATTGCATCGCCCGGAACGACTGTGAGAAAGCCACGTCTGCCAACGAAGACAGGTCTTTAGGA
TTCGCCTCCAATACCTCCTTGGAGACTCGATGACCTAAGTAATTCACCTTGCGCATCCCCCAATAACTCTTCACCACGCTGATAGAGATATTCCACTTCG
TACACGCCTCCAGTAGGGATGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCTGGATTATGATGCGTTGATATAGGATCTGCGTCCTAACACAGAT
GGAGTCCTAGAATCCCCTGGATCTCCTGATTCGAATGGGTCCACTTCCGTATGACCTTCCCCGGATCCATCCCCTTCGGATTCCGGTATTCGGGTAAATC
CGTAGAGGGCGTTATCGATCAGGCGTTGGTAGATTTGGGGTGCATTCTTCAATCCAAACGGCATCCGGCTCCATTCGAACAGTCCAAATGGTGTGATAAA
TGCGGATATTGCGCGAGCCCAATCCGTCATAGTCACCACCCAAAACCCGCTTGCCATATCTAGACAACCGTACCAGAGTACTTTATCCAAATCTTCCAAT
ACCTCATGGATTAGAGGCATCGGAAACACCATCAATCTGGTTAGACCGTTAGCCATCCGGTAGTCAATACACAGGCGTATATCCACTCCGTTCTTCTTAA
CGATGTCCAACACAGGAGATGCCCACGCGGACGTTGAGAAACTGATGATTTGGCTTGCAGCAGACCCTTAATCAGATCCGATAGCTTTTCTCGGAACTGA
GGTGCCACCTTCCGCACCCTTTGAGCGATCGGCTTCGCGTCACCGACATCGATGTCACATTTGACTCCGCGTGCAGCTGGTGGTAATGCATTCCCTTTAA
CAATTAGCAAACGTCGGCTTTCCCTGATCTTCTGACGTAGCCGATCCATTTCCGCGGGCTCGTTCGCCCCTGGATCCACTTGGATATCATCAACCGTGAC
CTCCTCTGTGGTCCGCGGTACCTCCAGGATTACCGCCATACCTACTCCAAGATCTTCGGCGTGTAGATCCCCGCCTTCATGGTAGCAGACTTGTTCATCG
TCAGTCTTTGTCGGATCCACCACTGGATCCAAGCACCGCGACTCCCCTTCTCCCGTCATTTCTTCTGTTTTCATGGGATCGGGAATCCTGGTACCGGGAA
AACTACCTTTTGGATCGACTTGATCCTCTGGTGAGTTTACCCACGACGGTTCCTGTTTACCCCGGTGCTGACACTCTCGACAAGGATCCAGGCACTCTGT
CCAATGAAAAGCTTGGGTCCAACTGTGGGTCAGCAGGATCCAGCGGACCGGTTTTAATTCCCTGCGATCCCCCATCCACAGACCCTTGGTTACCTAGGGA
CCGGCTCTGGGTATCACCAGCGGTCTTGGATCCAGCCTCTACCACTTGGATCCCAATCCGACGATCCCTATGTAGGATCATTCGCGGAGATGGGTATGAA
GGCGGATCCACCAAAGGGCCAGTTGGCTCCGCCGGGAGTTCCGCCTCCCCGAGAGATTCAGGCTCGGTTGTCGCTTCATACGCCAGATTCCGCCATTCTC
TATAGCAACGGGACCCCACTGACACATATCCAGGTCGCCTAGGGATACCATCCTTCGCCAACCATCGTCCAATCTCCTCATAGTGGTCCAGTAATAGTCT
CTTGTCGCTGACATTCGTGACTTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACTCTAGGCACCCACTTCTCACCCCGAGTACCCACCGTTTCTCAT
GTTCTACCCACTTCAACCGATGTGGCAGATCACAGGTCTCTCCGGGCTCGATCCAGGTCGTCTTATTCGCCCTTATGATCATCATCGTCGCCCCGTACAA
CGGTCGTCGTCCACTGAGCTGGATCCGCATCTCGTCCGGGAAGCACGGTGTCCCATCTGCCAGATCCAACCTTACTCCGGCTGGTATCATGAAATCCATC
CCGAGGATGGCGTCTTGACCAGCGAGGTCTCCGACCCAAATGTCGAACCAGTATACCAAACAACCTGCCAGCGTGATCTTGATCCGTGTTCTCCCATTCG
TACGGTACACCCCTTAACCAATCCCAGCACAATCTCGGATCCGACTCCCATCCACTTGGCACCCAACTTACGAGAAAAGGCGGTATCTAGTATAGACACC
TCGGCACCACTATCTAGGGGTAGGTTCGCTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTA
TCCACGGGACTCCCCTGTCAGCAGATCCATGGATCCACCATCTTCAGATCCCCGGGATCCAGTAACCTGACAAACCTTGGGTGGATCTGCAGTGACCTCA
CCCTTGGTAGGCTCAACCCATCGACCATGTTGTCGCGTCTCCCAGTAACCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGG
CAAATTCATCCACTTGGCGCAAACTAGTAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTTCTGCTACCTGGATC
TAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTATTGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGG
CCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCTGACGTCGTGAATCTC
GCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTTTTTAGCATCCAGATTCAGTGT
GCTTCCGGGATCCGCACTGTGAACACCTGATTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGG
TCGAGAGTTGTCTTCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGAT
TCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCT
TCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATTCAC
GTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGT
CGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGGACTGGGTCTATAACT
GCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTC
TAAGCATCCGACGCTTGGTCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCA
GATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATC
CAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGC
ACGAGAGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGC