Description :
From Genome Similarity Track
Location :
Scaffold_1596:546- 2655
Transcript NameFunction/comments
Phyag_g11056hypothetical protein

Sequence
2109 bases(100 bases per row)
AAAGTCGTCGGTTTCCCAAGTTACTCGGAGTTGGCAAATTGAGAAGTATTTGGAGTTGTTGAAAAGCTCGCTTTGTATCAAGATATGAAGTACTTTGCCA
GCATAGAACAGCTCAGCCAGATCGTTGACTGACAGTGCTCCCTGCAGTGTTAGATAGACGAGGAGATCAGATTAGAATTTGCTTCGATTACGCCTAAAAC
AAGTCTTAATTTACCATGGCTCCGACCCCGCTAGCAGCTGGAGACTACCTGCTGACCTTCCCCGAAAACGTGAAAGGGAAGGCCATCACGCCCTTCTACG
GCGCCGTGGCAGTGATGATCCGGTCGTCGGTTCGAGTAGAATTGGTCACTGACTCTGCTCCTGGTGCCTACGTGCTGTCGAAGTCCATCTCAAAAACCTG
ACGGGTCAAGCGGATGGAGAGCATCTAGGAGTCTGGGTGCGTTAATCCGTCTGTGTGAGGTCAGGTAATCTCCACTACTACGGTCAGACGAAGGAGAACG
TCTCCGTATTTCTATCTATCTAGGAGAAAAGGACTGTGCTGTACTGCAGGTGGTGGGAGAGGTTTACGCCgtgatcgccatcgtcatgGGGTCACAGCGC
TGGTCGGTTCGTCTGTGAACGTGGGAGGCCCGATAAGATGTCACAATCGACTGCTAAACAGCATTATGGAAGGAGAAGCGGGGAGGCCGCTCCCAATCCG
GGCCTCAAAAAGCGTGAAAATGTGGTCACGGAATGGCTAGTGCCAACGACGCGTGTATTACGTGGAAGGCAAGAGAGAAATTCCTGTAAGTGGCCGCTAC
CAGATTGGCGAGTCATTCTGCGCAAAGCCGCCGATTCGGGACCAGCTCGCAAGGACTCACAAGCGGATTCGATGTGGTTTTGCTCCTACGCCTGAACAAG
AGCGCATACATCTGACGGTCACGAACGAGCAGCACAAAGGTAAGTCAGGAGATGCTTATGTGGATATGtgttgtcgatggcgaaGTATGTTGTCCACCCG
GGAGTAGCGTCGAGAACATACGACATCTAATTCAGCACGCACGGTCTCTCCGTCATGTACTTCAAACGCTTGGGGCTCCTGGACAAGCTACGCACACTAG
CGCCCAGGACAGTCAACACGGCGGATTTTACCCCACGGTCCTCTATTCCAAATAGATGGGTCGACCTGAGTTCGTCAACGCTAACCTTCCAGGACTACTG
TCGCGACATGTGCGACGTGACGACTGTGCAAGTAGCAGAATCTCTTGACCAGTTTGTCCTCGCGATGGAAAGCAGGAAGCTACTACGTGAGGCCGAGCTA
CCTCTATTGGTGCTGTGGATCGACGCAACTCTCGAACGCTACAGAGGAGCTGTACTACGCGATCTCCGCCATGACACGGCTAGCAGGcttgcagcaacgt
cgagGTTTTCGATGTCCAACCCTGACGTCCACAGTCTCTCCGCGGGTCTCGGCGACCGCTCCAATGAAAGCGTATCGGCTCCCTTACAAGATGACAACGC
GTGCTCGGTGCTCATGAGTGAGCAAGGACGGTGTAATGCAAGCACCATCTACACCTCACCAACAGCCGTGCACGACGATAGGATTCAAGCTTGGCAAGTA
ACAAGTGCAAGTTCAACTACAAGGTAAACTTCAACGCGCCTCCAGCGCATGCCGACACTAGCCGAGGGAACTCTTTTAGTTTTCTCATTCTCGATTTTAC
TTCATAAATCACAAGCCAATACAACTTTCGACGGTTCCTGGCTTTATCGAGTTTCACTCGCCCAAGTACGTGACAGACGGAGTCActcaacaacagcgac
aaTCGAGCGCAAGATCCCCGCTGATGTTATTGCTAGTATCCCTACACGAGACGGCAAGGAGGTATGCCTGCACTACCTGTCTGTAGCGGGGTTCAATCAG
CAAGACCCAGAGCGGTGTTTGTACAAAAACCGAGTTCATTTCGCACCCGCGATGATCCCACCAAAGCTTCGCCTGTACAGCACCTCTCGTCTCGGAGGCC
TCTGCAAACCACAAAGCTTGAAGGCGTCCGAGTCGTGCCGGCCATCCACGACTCCAACAAGGTACTCGACCGCTCCGATCTCTACGAACGATAGCGCTCT
CGACGACTG