Description :
From Genome Similarity Track
Location :
Scaffold_54:54593- 57245
Sequence
2652 bases(100 bases per row)
TTCTGTCGATTACGGTACTGCGTTGATAGGAGATCGTGAGAGGTATGCTAACGCTGACAGGTATCAGCAGAGTATGATATACGATCATGCTATAGCTGCT
CTAAATTCTGCAATCGTTATACTGGGTTGGCTAGGATGCGAGGGCACCCAACAGGCTCTACTCGCCGCAATTTACCACATATTGAGCATACAGAAAATGA
ATTTGATTCTGCGCAACGTCGACTGTGTGAATGCCGCGGACAACAAGAGCACAACGAAAGACCTGTCGTCAAGTTAAGCAGCGCCTGGAGTACCTCCAGC
AATGTGACGTAACAACGATATCACGCTGTCCATATTGTACTTGATGCTGTCGATACTGATTTAAACATCAACATGTTGATGTAGATGTTGATAATCGTTG
ACAATTTCCAGGTTACTTTTACTTAAATGCCATCACTAGGAAGTTAAACTCCCACCAACCGCACATAAAGTCGTGTTCGAATGGCTCTCCTACAATTCCC
CGAAGCTGTCCACCACAGGCGGTTCAAAAAGATGGGTGTATTATAGCGCTCAAGAAAAATTATAGAATGGGCAGCATAAAAGATGAAGTTTTCATTGACC
ATCGATAGACCTTCAAAACCAATTACTCGCATTATGTATGGATTGAAGGATCATACGCGAAAACTGAAACCACATTATCCTCTCCCTAAAATGTACAATG
ATGGGCGTCACATCTTTAAAGAATGTACTACATCGCTACTGATAGCTCAAATTCAACTTTTACGTAGCGGCGTCTTCTAGTGATCAAAAGGTATATGATA
TAGCTACAGCTAACTCAGTAAACTATTGACTAATCGGGGGCCGATGCCTCTACTCGCCAGACTTCGGTTCCTGGAGGATGGGGCAAAGTAAAGGGATCGC
CCGGCTAGAGAAGCCACCCTCCCACCAAGTAGCAGCTGCACACTTAGATCGCTGAAATGCAAGAAGGACCCACTGTGGAAGGAGATGACGACGCTGACCT
GTGACGACCGTCCGTACAGGACATCTAAGGAGGATTTAGCCCCATTTGCAGCAGATTTATTCGGGTATAGTTGGTGGAAGGACTCAGACGGGATCGATCC
TCGTGAGGGAGGGATGTTCGCACACCACTGAACCGACCAATTAGAGAATTATGCCGTATTTAAAGAAGCGGACTTGCGCATGATCACAGATGCGGTCAAT
ATGTTAATTCCTCGTCCCATCCAAATAGAGAGCGCGGAAAAACCAAAGTCACAACCACCAGGGCCACCCAGGAAAATATGTTTACTGGCTTAGCCACCAA
TTGAGGAAGTCAACTGAATTTGGACAGGCTGAGTCTGAAAGATCTAGTGAGCCGGCGTTATTTGCAAAAGCGTATTCAATTGTACCGTTGAAGCGTGAGG
CTATTAGACTGTAGTGTGGTTGTCCTCACATGTGCAGAAGATGTAGGAAGTAAACGTGAAATATATTGAGTGTTAACTATTCTCTCTAGTCAACCCTATC
ATATGCATTGCACCAGCATTGCAACTTGACCTGGTAAAGGTACACTTGGCATACATCCAGCTTGCCCATCACCATGTGCTGGTGCTGGTCCCACATGACG
TCCGTATGCAGCTGTTTCACCTGCCATCTGCCTCGATAGTCCGACATGACGATCGTCTTCTCTCGCCCCATATGTCGACTTGTCTCGTCTTTGTCCCACC
TATCAACTTGTCAGCTTATTAGTGAAGTCGCCCTTTACTACAGGCCTTGCAATCTATGCCGGAAACACCATTGCGTGTCAAAGACGATATCTTTTAACAG
AGGCTCTGCCTAAAACTTGGCAATAATACCTGGCTCTAATTAGCCTGAACGAGGCTAGTCTCCCTGAACTTTTTGTTCAGGTGTATGTCACCGGAGACTA
CACTTTCTTGGAGTGGTAGCAGCTTGCAACTGCTGTACCAACAAAAACTATCCTTTAGTGGATTGAATTATTAAGGAGATCGTGCAAAAATTGACATAAC
GACACTAATGGTATCAGGCAACAGTATTATATAAGTGGGCGCAAGTATTACTAAAGGAGAGCCCCCCCAGTAAAATGACGTCTGCAATCGACGGTTTGTC
ATGTTTAGCCACGCCAAATGCACGCAAATGAGATCACCATGCTTCTAATCTGTGCGCATCTTCTATTAGTTCAGCTTCTCGGCACCACATTTGCGATTGA
ACGGATAGAGGTTGATTAATAATCGCGGGTATTGTTGAAGGAGTGAGTGTGTGCCGGAGGATGTCAGATTTTCTGCGAAAGGACCTTTAAAGTGTGAATA
TGCTTTGATTGTACAGTACGGTCCAAGCGCAGGTTCAAGGCGAGATGAAGCTCCACCTTTAGATTGACGCTGAGAATTCAGGTTATTCTTCACTATACAA
AATCATTCACTGACTAAATGTGGCTTCTGCTAATGAAGCAAGGGTGTGTTTACCGGCTCTGAATCAGATGTTGGGAAATAACGACGACATATATATGAAT
TGGTTTAGACATCGATACATTCCCATGTCTTTACGCTGGAAACGGCGAAGTATCACCATAGATTCAAGTGCCGTATTAAGGGGTTGTTTATATTGTGCAA
AACACATACTGTATGTAGAAGGGATCGATATATTTACGTAAGCAAAGCTACC