Description :
From Genome Similarity Track
Location :
Scaffold_55:5458- 8580
Sequence
3122 bases(100 bases per row)
TGGCACTTCGATTAGCAGCTGAGTTCCAAGTGCGAGAGAAAGCACGACGAGCTCGAGAGCACAACGAAGCGTTGAGCAAGAAGGAGAAAAGATCCATTCC
CAACACAGCAGATGACGAAGATGAAGTTGCAGAGCCAGGCGATGAATCCCCCGAATCCTTGTTCAAAGAAGGAGATCAAGTCTGGTTGTTTATGGAGCGA
GTCAAGTCGGGCCTGACCAAGAAGTTAGCCCACCGATGGCATGGACCATTCAGGGTGAAGAAGAAGGTGGAAGAATTCGCCTATGAATTGGAGTTACCCG
ACAAGAGTGGATATAGATTCTACCCAGTGGTCCATGTATCACGTCTGAAGGCAGTCACCGAACTCGGCGGAAGACCAAAGACGAGGCTAATCGCCGACCT
CGAAGAGACTCAGCGATTTGACTTTGATGAAGAATTACTGCCTGAAGACAGCTGGGAACCAGACACAAGTACAAACCAGTATGAAGTCGAAGCAATTCTC
GACGATGAGCTACCATTATCCACAAGTACGTCACGATCACAACGGAAGTTTAAAGTTAAGTGGGTCGGCTACGATGAGCCTACTTGGGAACCACTGTCGA
ATTTGTCATGTGGGGGTCTCCTGTTTGACTATCTACGACAGAAGAAGCGCGAAAACCGTCTGCAAATGGTGCAAGTTGCAGATGAGGATTAACAGCTATT
GCACCAAAAGTTACACCAACTCAGCGGACGACACAGGCCGAGTTGAGACGGAATGCTACTGTGTCGAAACTACATATATTGAATAATTACGAAATGAAGT
CCTGAACGATACCTACGGGACGCCCAGTCAAAGGAAGAAAGCTAAAAGGTCGGTGATCCGGATTCCAAGTGAGCTGAACCCGACGGAGACAACTGGGAAG
AGCTCAGCGGACCAGACGATTGGGGGCGTGGCGTCGTAGCAGACGTCATCCCTTGGGAACTTGCGGAAGGAGATGCAACATTCGCAGCCGTGGCAAGAAG
TATCATCGCCGAGCTAGCCAACGAAGCTGACGCCGAACCAGGTGCCCCAGGACCCGACGCGGCGGAAGTGGGCTGAGGATCCGTTCCACTGGGGAGTGGG
GTGCCGAACGGAGACGTACTCGGAGACGCGCCTCGGAGATTAGGAGAACCCAACCCATCGTCCGCCGAATCGTCATCAGACGCACTCTCGCCATCTGAGC
CGAGCTCACCGATCGAAGACCCAGTGAAGATATAGATGCCTTGACGATTCAGCCGAGTTGGAGCACCCGGGGCATAGGCAGGAGGCGCTGGTTCAGCAAG
ATCAATATCTTCTTCAATCGCGTCGTCAACAACCTGAGGATCCATACCGCGCAGAGCGAAAACCAAGAAGTCCACGTTCCGAGCGCGGAAGCAAGTATTG
TACGGATGGACCGCCGGGTCAGTAAGCCACCAAGCTCGCCAGGGCTCGGCTAGATCCACATCGTGAGCACACTGGACCCAGTCTCTCCCGGAAGGAACCC
ACGAAAGGTTAACGGGAGAGTAATGGGGAACGGACGGATCAAAATAAACCTCTGCGTCCACCAGTGGAGCAGGTTCATCGCCGAGCTTCTGAGTGACCGC
CGAGTAAAGCTGGTCGTAGACAGCAACAACCAAAGATCGCAAGGTGTCACTACGACGTTTGCGCTCGCGCTTGTACACCAGCCACAGTTCGTATACCTCA
GCAAGCTGGGCGGGGCGTGGCAGCCGGGTTGACGTCAGGATGGAGACCCATTAACACACTCGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGCCGTCAAGAGAACACGGCGTAGGTGGCACACGACTCTTGCCT
CCTACGAGCTCCATCTGCACCCCTCCGCTCAGTGTATCCAATAATGCATTCCAACAACGGGCTGAGCCGAAATGCATGAATGGTACCTCGCGGAGTTGAG
CCATGTGAAGAGTCAAGCGACAATCCTTGGACACCGCTTGCGAGGCTCGAGTCCGTAACGTCGCCAGCGGGAGTGTAAGAGCGCTGGGTAGTGCGACCAA
AGCCGGACGTGAGGCAGTCGAACTCGGCTGAGAGAGAATCGATACAACCGGGAGCCTACTCGGCGAAGGAGCAGCCGGAATGGATTGAGCCGGAGCTGGA
TCAGGAGTCGACGGAAGCTGCCGATGCTTGTGGTGTCGGTGCGTCTTGTGCTTCTTGTGCTTCTTGGATCGCTTCGACCGATGACCGGTAGGACTCGACG
AGGCACGACGTTTGCGATGCTGCTGCTTCCCCGAAGCCGGCGCAGAGGCAGAACTCGTCTTGTCACCAGAATCCTTCGATGAAGGCCGCGAGGAGTGGCG
ATCACTCGGCGGCAAGGACTCATCACTCATCTCGTCGTCAGAGCCGAAGATTGCCGCATGAAGGCTTCTCGCTTGGGCAGAACGACGAGCATCTGCGGTC
GCTGAGTCGGAGCCTGAAGGACTGCCAGCCGAGTTCTCTGATAAGGAAATGGGATCCAAGAGCGACCCAGCGGCAGGATTTGTCGAGCCGGTGGACGGTA
CGGAACCATCACCAGGCCCTAACACCTCGTCGTCAGACGCGTCGAGGTCCTCAAGCAGCCGAGCAGTCACAGTGCGGGCGGTCGCAGCAGATCTCCGGAT
AAGGCGCCCAGATGGGGACGTCAACACGGCCTTGGTCACAGGGAGAGACGGTCTGAGGACACTCACGGCCGGAGTCACTAGGTCAGTCGGCGTGGTGGAT
ACGCTCAGACCCCGAGAAGACGACTGGGAGCGCCCAACCACCGTTAGCACGACGCTGAGTGGTGCACTCGACTGGGGCAACCCAGCGGAGATGGGCGAAG
TCGAGCCTGGGGCACAAACGCT