Description :
From Genome Similarity Track
Location :
contig_15:545753- 550564
Transcript NameFunction/comments
g3460.t1hypothetical protein
g3461.t1hypothetical protein L914_18752
g3462.t1conserved hypothetical protein

Sequence
4811 bases(100 bases per row)
CGAAACCCTCGAGCTCCTGACTCTTCCGGCGAGCGCACTCGATCACTGACGAAGGAAACCCCGCCATTGAAGCCACGTGAACACCAAAACTCTCCATGCA
AGGCCCGTCGCGCACCTGGTACACCATCGTGATCTCCTTGTCGCTGGCCACGGCGGTAACGTGCTTGTTGGCGAAGCCTTGCGGGTGCTCTTGGTGCAGC
GCTGTCAGCTCGTGGAAGTGTGTCGCAAAGAGGCACATCGAGCGCGCCTTGGTGAGCAGGTACTCTGAGATGGCCCAGGCCAGTCCGAAGCCATCGTACG
TGGACGTACCTCGGCCCAATTCATCGATAATCACCAGCGAGTGCTCCGTAGCCTTGTGTAGAATAGCCGAAGCCTCCAGCATTTCCAGCATGAACGTAGA
AACACCGCGTTGTTGAAGATCGCCCGCACCAACGCGCACCAACAGCTTGTCGAACACAGGCAGCCTCGCGACTTCTGCAGGCACAAAACTACCGATTTGT
GCCATCACAGCAATAGTGCCCAACTGACGGATGTAGGTACTCTTACCGCCCATATTAGGCCCGGTCACAAGCTGGAAGCGCGATTTCTCGCGCTCAAAGT
TGTAGTCGTTTGGAATGAAATCGACTCATCCTGCAGCTCCACACAAGGGTGGCGCGCACCTGTCAATATGACGCAGTCTCCATTTTTCTCCATAGTAGGG
CGACAATAGCCTGAGCCAGCATGGCATGCCGCGTGGGCGAATCCAAGCAGCACATCCAATTCTGCCAGTGTTGCAGTCGCAGCCTCGAGCACAGGTACGT
ATGTGCTAGCCACATCAATAGCCGCGTTCAGCAAGTGCGCTTGCCGCTCCTCGTATTCGCCGCGCACACGGCGGTACTCGGATGCCAGGCCCTTTAGCGT
CGTTGTAGTGAATTGGACTCCGCTCACGAGGACTTGGCATATATGCACCTGTGGCATCTTGGACAACCGTGCCTCCTCCTTCTTGTTGGTAACACGGAAC
GCGAATCCGCGCACCTTGTCCTTCTCGCACTTGATCTCACCACCAATCGTATCGAGTGCATTGCGGTGTTCCTCCTCAATGTCCGCAACGATGCCATCCC
ACTCCTCACGCAGCGCCTGGAGGTCCTTGTCATGCTTTGCGTTCACCACAAGGGTCGGACGGCTGTCCAGATCGACAACCTCCTTCACAAGCTCCGTGTA
GCCTTGCAGATCCGCAAGCTCCTTCTCCAGTGGAGCGGCAAACTTCTCCTTCACAAGAGCGGCCAAGGCCGTATCTCCACCCGCCTCCGTGTTTTTCAGC
AGCTTCAGCACGCGCGGCATGGCGCCGACAGCAGCATCGTACACACTACGAGGTCCGTGATCTTTGCATTTTTCTTGCGTTCAAGGCTGACCGCCAGTCG
CCCCAAGTCCGGCAGAGCCTTCATGCACTCGTCCAGCAGCTCCATCCTCAACGACGAGTCGTCCACAAAGAGCTGCACGAGGCTCTGTCTCGTCTCGATC
TGCTCGACATCCAGCAGCGGCTGTCGGATCCAGCGTTCCAGCAGACGGCGTCCCATGGGCGTCTTGCCACGGTTCAGGATCTCCAGCACGCTGCCTCCGA
ACCTCACCCCCGTGGTGGTAGCGCTGGGCTCCGGCAACAAGTTGAGCGACCAGACGGCAGCGCTGTCAAGCTGCATGGCTGACGCCAAGTTGCCCTGGCT
CAGTGTGTAGCAGCCAAAGGTATCGGCGTCAGCCATGACGCCCAGCGCCTCGATCAAACAGGCCAGTGAGCCCGCCGCCAGCTTAGACGAGAGCACGTCC
TGGTACTCGGCCATGGTACCGGCTCCCAGCAACCTGGAGACGTTGGTCTCGAGGCCGTTGGCGTCGCTGAAGAGCTGCTTCTTCCTGTACACTGCGGCCA
CGTCGTGGGTCTGCAGCAGCGCGTGCAGCTTCTTGCTGTCGCCCACGCTCTGCGTCGGCTCCAGCTCCGCCGACAGGAAGCACGTGGAAGGCGCCAGCTG
CAACAACAGCGACTCGAGGTTGGCCAGCGCGCTCGAGTCGGAGAAGGAGAAGAGCACGAGCTCCCACTGCTTCCTGTCCTCGCCCGCCTGGCCCTTGACG
CATGACGCGCGGGCGCGCGGCCGCCGCACCGCCACGCCCACATGCTTCAGGTGCTTGTCGTTGCGGATTTGCAGTGCCACCTCGGCCTGCGCTTCGTCCA
GCAGCACCACGGACGAGTCGTCATCTTCGCGGTCGGCCATGGTCTCCTTTCGGACAATTCAAGAGTGAAGGTCGGTTCAATAGGCGCTTCCCGCGCTTTC
TCTGTCCGGGTTGAATGTCGCAATGTGACTTCTTCAAGAGAGAATGGGTCTTTTAACCTCGGACACTTTCGATTGCTCAGAATGGCGACGGATTGGCGTG
CGGAGTACGTGAAGGCGGCGGCGCTGGGGGACGCAGGAGACGCTACTGGGACGTTACAGCGGTGCAACAGACGGAAAAGACGCCGGTGGGCGGTGTGCTG
GCGTTTCTGGACCTCCTGCTGACGCAGGAAGGCGGCGAGTGGTGGACCAAGCTGCAGAGGAAGGCCAGCGACGGCTGCCAAAAGTGATGGTCAAACAGTG
GACTCAAAGGACCAGAAGCAGCTGACGGCGCTCAAACACGGCTTGCAGCAGTGGGGACGACACTCGTGCTGCAACTGCCGCAGCTGAACGCGTCTCTGAG
CAAGGAAACGGCCAGAGTGCGCGTGCTGCAGCTGCAGCTTGTGTGCCGTATGCTGTGCTATGCAGTGCTGATCAAGAAGAAGGAGAGGAAACTGCTGAAG
AAAGAGATTCAAGGATTAATGGACCGGGTGGCTCTGCTGCTGGATGCGGCGAACCCGCCGTCGCTGGCGGATGAAGACGCGGATGAACGCTCGCCGTTCC
AGGAGTTCCTGAAGCAGCAGTTGGCTCCCAGACTCGAGCTGCTGTTGCCAGAGTTGATGCAATATTTGCTGAAGGCATACGAGATGGAAGTGGAGGAGAA
CAAGGCCGACGAAGATGCGAAGGACTCCAACTTGCTCTTACCGACCGTGAGTGCTGGTGTTATCTCCCTGGTAGAGCTTTGTATGTGACGCTGATCACTG
ATGTTTGTGGCTTGTGTGCAGTTGCTACGGTGGTGAAGCCTCCTCAGTCACCTGCAGAGCTACCGACTTCTGTTGCTAGTGGCAATGGTAGTATTCTGTC
TGCGTTACGCCAAGAACGGCCAGCAAAGCGTGCTCGCCCCGAGGCTAGCGAGTTATTCAAGGAAGTCACGCTCCCGCATCAGTTGCAGCGGAGGCAGAAG
CAATCTCACCCTCGGAAGTCGAGACGGGTGACCAATAGCCACAGTAGCGGCGCAAGTAAAGCAGCCAGGCTCACTGCTGCGTGCGGCGGCTGGTACTACA
TCACTGCACGCACCAAGAAAGCTGGAATTTGCGGGCAAAACAGCTTTGTACGGCGCAGCTTCAAGTGCTAGACAACCTGGCCAATCGAACTTGCTGCGTC
GTGCCGCTAATCCGTCCGCGCCGAAGGGGCCTGCGCGCCCTTGCTCCAACGAGCAATGTCGGAGCGCTCTCACTTCCATGGCCGCCAAACGCCAATAGGT
TCATCGCCAGGTTCTGCTGCACAAGATGCCGGAGTCGCTACAGCTGGCAAAAAACAATCTCCTGGATCTGCATTACGGCGCTCGCAAACCACTTCATCGG
TAGTCATGCGAACTCCAGACAGACCGAAAAGAATGGCAGCACGAACCACGAGGCGCGTGCTCGTCGAAGCATCTCCTCCACTGCGCAGGCCCACCGCAGC
CGCTGTGCCTCGTCTTCTTCAGCCCAAGTCGTCTCGGCCAGGTTCCAACCCACCTCCTCTTTTCCGGTGACGGTGGCACGCGACCCGAATAATAGACAAC
GAAGACTTTTAAGTTCATCGGCATTGCCTAGCCATTACTATCTCGTGTGAGTGTTGTTGTCATCGCTGTCGCTGTCGCTGCCATATCCCACCAGTCCCAG
CGCCGCCGTATTCGGCTTCTCCTTCTTGGCAACAGGTGATGTGCTGGTGTCTTTTGGCTCGACCTTCTGCTTCTTATTGTCCGGTTGTTCCTTGGTGGCA
TCACAACTCTCGGCAGCCTTCGTGCCAGCCTTACACGGCTTATCCTTCCCAGCCTTTCGCTTGGCCCGCACCACCACGACCGGGGTCTTCTTGCCTGCCA
CCTTCACATCGTCTTTCACCGGATACTTTTGCAGGTGCTGCGCTGTAAGTCCCGTCCCAGCGGCGGTCTTAGGCGCACCGCGTGCCACCACTACACGCAC
CAAACACAACTCGTCGATCAACACCAACATTAAAGCCACCAATAAACCCTTCTGCCTTACGGAATTGCGCCAGGTCTTCTTCATGTTGCGTCTGGCGCCT
CCGTTGAACGTCGTCCTTCTTACTCTCCAAGTCCCGAATGTACTCGAACTCTTCCTCATCCAAACCCTTCGGGGGAGCTGTGCAGCCATAAAAAACGAGT
TCGAATTAATTACCGCAGCAACCACAGCCACAGATGCCACGCACCGAAGGGATTGTTCTTCTCCTTCCAGTCGCTGTCCTTCTGGTCTTTGCGCTCTTGT
AGCTGCTCGTACAGCGGCTTGTAACCTGCCGCGTCCTCTGCTCGAGGCGCGGGCGCCTCCGTCACGCGCTTCTCCTCCACATTGTCACCGAAGAGCTGCA
AACACGAGCCGTTAAAGGAACCGCAATGCGTGACCAAATCACTAGACGATACAGGGACACACCCCATCAGATGACGTGAGCACGGAGTGGACACAAAGCC
CGCCAGAGACG