Description :
From Genome Similarity Track
Location :
Scaffold_118:54571- 56831
Transcript NameFunction/comments
Phypl_g3542hypothetical protein PHYSODRAFT_473969

Sequence
2260 bases(100 bases per row)
GATTGGAAAGCTGCGAGATTAAAGGTTCGTCTCGAGCTGTATTCGCTTTCGTCCCCAGAAGTGCTACCGATGCTTCCAACGGATCTGCTGTGGTCCCTCC
AGCGGCTGAGTAGAGAATTGTTGCGGCCGATGGAGCCGCTGTTACCAGGGTAATAGCGTGATGTGCTCCGTCGCGCATTGGCTGGCGAGTCGTAAACGCG
GAGAAACACGTTGGTTGGGGAAGCCACGGAGTCTCGCTGGTCAGGAATCGGGTCTGGCAAGTCTGCCGGTGTAGCTGGACCAAGCGGTGGTGTCGCGGGA
GGTACTTGGTAGCCACCTCCTTCCGTGTAGTGACTTCTAAGGAATGAACGACGCATGATTCTCATGTGCGTCTTCACATCCTCCTGAGTCACGTTGCGAT
GCTTCCCCCCCTCTCCTCCATTGGTGGCGTTGAGATCAACGAAAATACCCGTGAGGCTCATCACGAGCACAAGACTTGGCATCGTGAGTGGTGTGATCAC
AAAGAGTGACAACGCGGGGAAAATCACCATGAGAGCAAAAAGTTCCGATCCGCCGCCAGTTGACACCGACGAGTCCGACATACTGCTAATCTCCACCAGC
GAAAGCCACACCAAGTAGAAAGCTTGCCCAATCGTGGCAAATTGAAAGAGTCGCAGAAGCAGCTTTGGACTGTTGAACCAGAATCGGTCGTCATGGTGGT
GTAGCTGTCGGTGGCAAAGTGCCGACATCTGCATACGGATCATAGCGCGAACAGCGAGTGCCGCAGCCTTGAACTTCATCGGAGGCTTTTTGGGTCGAGA
GTGTCCGTCATCAGCGGAGTCTTCCTCGGTCGAGTCCTCGACAGATACTGGTGCTGAGTCTGACGCGGAGGCATTGTGGTGCCAGCGCTTGAGCCCCCGG
TTGCGGTTTCCCGAggtcttgagcaccttgtCAAGCCGCGCCTGGATGTCCCTCGTGGTGATAACGCGGAGGCGGTCGTCCACGATTCCGCGTAGAatct
tgagcaccttgaagAAGATAACGACGTTCACGAGTAACAGCAAGCCACCCACACCAATGAAGATCCAGTGATCTTGCTTGGGGAAGATAGACGGCAGCAG
ACAGATGACCAGCAGGATGATGAAAGCGCTTGGGTGGATGTTGGTCATGTGGTATAGCAAGTTGCGCATGCAGAGCACATGGTACTTGGCGTAAGTCATA
CGattctcgtcgtcttcgcggTCGGCACCTTCCtctccttgagcaccgccacgttcttgagcagccCACGAACGTGCTTGAGGTTTTGGCCGGACGCCAA
AGAGCCGCTCCATCTCGACAGGGTTCTTGTAGATGTAGCCGCTTCTGTTCTGGCAAATGTTGTACGCGAGGATTTCAAAGCTCTTCCAGAGGTTCCATTG
CTTGcggatgttgaagtggaagcccCAGCCTTCACGTTGGTAccgctgaagcagcaggctgTACGCACGCGAACCCAGGACAAAGTCCATGCCGGACAAC
GCCCTCGTTctcatcgccatcgtgcGATACACGCCGTCCCCGTCCGAGCGTTGGCGAGCTCGCATGGCAACGTAGTAGTCGTCGGACGGGGTATCGAGCG
TACGTTCGCCTTCCTcaatgaagctgctgccggtgctgtgCCGGTTGATATCACGGGCCAAAGACGACGCGTCTCGGATGAAAGAGTGGGGCATGCGGCG
TCCGCTGCCAGCACAGTCGTCACGGTCACTAGTGCTTGGGTATCGAGCATCGTAGGTGTTGTCGTGGATGTCACTGCGGCTCTCTCGACGCTGGTCGGGG
TGGTTCTTGATCCCCCAAACGAGTTTGGGCACGACTGTACCGACGAagagcagaagcagcacgatgatgatgaagtAGATCATGGTCAGGAACACGATGT
AGTGGAAGAACTCGTAgaagtggagctgctctGAGGCCGTGAGATTGTTGAGCGCGAGCGACTTCATGGCTCCGCTCGTGTTGAGCGTGAAGATGACCAT
GGACAGGAAGCCCATGATCATGACCTCCTCGAAGATGCGGTTCACGATCTTACGAAGCTGCGGACACTTGATGGCGGCGCGAACGTAATGGATAAGGCGG
TCCACGCCGATGGACACCGCGACGATCACCGCGAGCAGGAACACGGCCGTGCGAAGGTTCTCGTGCAGACACTGCGTGTTGCCCACGCCCAGGAACGACG
CCGAGTTGTGGCAGTAGCGGCTGCCTTGCTCGTCTCCGCCTCCCGCGAGCAGTCGCTTCA