Description :
From Genome Similarity Track
Location :
Scaffold_192:5457- 7180
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_192-snap-gene-0.15Tigger transposable element derived 6

Sequence
1723 bases(100 bases per row)
CCGGCACCCGCGGCGGAGGGGCCGCCTGGAGACTTGCCGTCATCTCTTGGAGCAGCTTTTCGACCAGCGCGCTCTGCTTTTTCAGCTGCATCTTGGTCTG
TTTGCTCTGGTGCAGCGCGTCCATCTGCGCGTAGATGTCGCCGCGGAGTCCCTTCCAGAAGCGGTGGAGGTCCTACNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTCCCGCGCCGGCGAAACGATATTCGTACGCCCTACAGACAAAGAGAGCTCGTGGAGATCTGTCTCATCTAGCGCTACCTCG
GGAAGGTGCGCATTGAAGAGCCGCAAGTGATACACACGCGTGACGCGCACCAACGTCTCGACGTCGAGCAGCTCCAGTCCGACGTCGCAAAACACGAGCA
GACAGTCGCGGGGCGACACGCTCTGCTGGGTGACGCTCGTGACGATCTTGATGAACTGCTCGAGGCCGATGCGGTGGCTGCCCGTGGGGTCGTGGCTCGC
GAACGCCTGGCGGTACCGTTCGTCCATGTGGCCGTTCACGAGCCGCCACTGGTCGAGAAACACGCCCATGGCGTCGTCCAGTTCGACCCGTTCTTCTGTC
GTGGTGGCTGGCATCACAAGTGGGAGCTGTTCGAGCCGTGTGAGCAGCTCGTCCATCTCGGGGCCGCTCAGCAGCCGGTGGTCAAATAGGCGTGCGGCCG
TCACGATCACAAACCGCTTGTCCACAGCGCAACTGCCGTCCGACGTCTCTTCCAGGCGGCAGTCGGGCTTGAAGATCTTCATGTGGCCAAAAAGGAGATG
GCTCAGCGCGTGCGCATAGTACAGGAACGTGTCGTATCCATCGCTCGCGTCGCCAGAGGATGCAGGCGAGTGGATACCACAGCACGACGCAAAGAACGCA
ATCCGCGGGTCGTCGGGGAAGGACGCCATCGCTTCGGACAATGCGACAAGCCACGCGCCGACGACCCGCGGGGAGTCGTAGCGCGTGACGAGATAGTCGC
AGACAAACGGCGCGAGGCTGTAGAGGCAATTCGAGTCGAGCTGCACAGTGTCGACCTTGAGAAACTCGATCCAGACGTCGAGCACAAGCGTCTTGGCATG
CGCGAGCGTCAGCAGCGGCGCGTGCAGTTGCCTGCTTTCACGGTGCTCGTGTTGTGGCGGATGCTGGCGCAGAAACAGCAGGGCAAACGACTGCCACATG
CGCGGCATGGTCTCCACGAGGGACTCTCTTGTCGCTTGTAGGGACGAGGCGCCACCATCGCTTGTCGCGGGGGTCTCATCGTCTTGCTTCGCGTGTGTAG
GCCGTGGTGGCAGCCGCTTCTTAATCCGCGATCCGGATGACGCACGAGGCGCTTTCTTGGGTTTCCCACGAGACGTTGATGCGTGTCCTGTCACTGACGT
GGACGCATGAGGGGCATGCGCCGGGGAACACACCGAAGAAGACGACACGGCATAGGACAGCGTGATCTCGTGCGGGTGGAACCCGACCGTCGCGATGAGC
GGCGCGACCAGCGCGCGAAACACGGAGGCGCCGCCGCGCAAGTACAGGCACTGCGCACGCTTGCGTCGCGAGAGACCGTCGCGAGTTTGGGCAAACGCCC
CGTCCACAGACGACCCGGTAAAGTCGAGCGCTTGGAGATTCAGCCCCGCGGTGTCACCAGAGACCACAGCGGAGTAAAGCCGCACGAGCGTCTCCCCGCC
GTGGAGCTGCTCGGTCTACAGTG