Description :
From Genome Similarity Track
Location :
Scaffold_465:5454- 8304
Sequence
2850 bases(100 bases per row)
AGAAGCCCCGTACTGATATTATGGCCTAAGCTGACCGCCATAGAACGTGGATGCGTGCGCATCTTACATGGCAGATCAATTGTGTATGCGTTGCCTAGGC
GGCGCAGCACACGAAATGGACCGATGAACTTGGATAGTAAGTTGTTACTACCCGCGCTAGTCACTGTGTGTCGAGGTAGGTTTACCGTAGATAGTAGGAC
TAAGTCGCCTTTGTTGAATAAAAGAACATTTCCCCTTCCATTCCTGTCAGCGTTTCGCTTTTTATCTACCGCCTCTGCGATAGAGTCTTGTACGAAACGG
ACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCTCTGTCTTTAGCTACAGGGCTCTTGGAGCGTACTGTAGAAAGGTCACTTGTCGCCTCTG
CGAGTGTGTCTTTAGACGCACTAGGCGTGATGCTGATTAGATCAGTTTCGTGGTCCGTAAGAGTATCTTCTCTCTTTCTTTCTCTTCTTCACCAAAGTCG
ATGTGATCGACATCGGCGTCGAACGTGGTGACGGCATCGTCAGCACGTGACGAGTGAGAGCCGTATTGGCGATCACTCGAATGAGTCCCTCCCCCCTTCA
AACTAAAGTCACACGTTAAAGGGTGGGCAGAAGCGGATGGCATAAGTCATTCACGAAAACGGCGTGTGCTTCGTCGACGCATGGACTGAGTGGCGGACTC
CACCATTGGCAAGAATTCGCTCCAATTCGTAAACGAATGGACATAACCCCAAAGGATTTCCTCAAGAACGCGGTTTGCACGTTCTGTCTGACCATGTGTT
TCAGAGTGGTCAGAGGTCGACATCTGAAAGCGCGTTCCGAGTGTTTTGAACACGGATCGCCAGAATTTCGCAGTGGGTCTCGATCAGCAACGAGTTCACG
AGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACACGAGCACATGCCGATGCATTGATAGATTCAGGTACAGCGACCAAGTGTACCATTTTACTG
AATCTATCAACGAACACAAGAATGCCTGTATTTGTGTGGGTCTGCGGAGAATCCAAAGACAAAGTCCATTGAGACTGATTCCCAGCATTCTGCCGGAATG
GGCAAGGGTTGCAACGGTGCACGAAGTGAAGGACCTGACTTCACTCGTTGACATACTTCGCATGCGCGGACGTACTTTCACACGAACTGATACTGGCGGG
GCTAGTAAAAGTCGCGACAAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTCATACAGGATGCGCAGTAGCAG
GTCACCATGGTCCGATACGACGACACGAGGCGTGTCGCCGGCAACGGCTGAATACTTCAGTAAGCCATTTTGGACTGTATATCGATCCGTGGAGGATCGA
TATATTGGGGGTAACCTTTGAAGAGATTGAAGGGATGGTTGCGAGAGATGATCCATCAAACGCACCATCGCCGGATCGTACGCCTTGCGTATGTTTTCGA
ATAAGATTGACGACGGGACACTCGACGTCAACACCGCGACAGTGGTCGGACCAGTGTCGGGTTACGCAGCCGGTTCTAAATCGGACCGGCGCGACAGAGC
ATCAGCGACGACATACAGTCGTCCTGGATTATATCCCACGGAGAAGTTATACTCCGCGAAGAACGACAGCCACCTCGCCATTCGTTGCGAGAGGTGTGGA
CTGTTAACGGCCGTGCGTAAGGACGCATGGTCCGTGTAGACGATGAAGGGTCTATCACCTAGTAGGTAGACCCTGAATTTCGCCAAAGCATACTTCATGG
CAAGGAGTTCCTTGTCATGGACTGGGTAGTTACGTTCAGCCGGTTGCAGCCGATGTGACCGATAGAAGACGACATGCTCAGCATCGTCTGTGTCGTACTG
CATTAGTGCACACCCGATGGCAAAATCACTTGCATCGCAGACCACATAAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCAAGCGTATCAAGCTT
TGCTTGATACCTTCGAAGGAGCGCTGGCAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAAAAGGGATGAACAGTCATCTCGTCGTAATTGT
GCAAATACGCCGCTAGGCCAAGGAACTTTCGAAGTCCTTTTATGTCGGTAGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCGGTCTGGAC
ACCGAGCTTACCTACGATGCATCCAAGAAGTGGTATTTCGTTAGCAGCAAATATACACTTCTTGAGGTTGGCGTACAACTTATGCTCGCGCATAAGTTTA
AGAACCTTTCGGACGTGAAGTCGGTGGACTTCCAAATCCGTCCGTCCATCCATAGCCCGGCTGTGGACGAACACGTCATAGAAATAGCTGGGTGCAAACT
CTCGCACTGATCTCAACAGATTCGTAACACATCTGTTGAACGTAGCAGGGGCATTACTCATCTCTTGTGACATTACTAGCCACTCCCAAAGCATACCGCT
TGGGGTGCTCACTGCTGTGTAAGGAATTTCCCTTTCACGCATAAGGATCTGATAGAACCCTTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGCC
ATACCATCTATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCAGTACAGTGGCAGCCTTTAACTTGTTGAATGCGTGAACTATCCGCCATCCTCCTG
TGGCTTTCTGCACACAGAAGGTCGGTGAGGTATGCAAGGAAGTGGACTCCCTCACATGGCCAGCTGCTAAGTGATCTGCAAAGAATTTGTCGGTCGCTAG
TACTTGCTCACGAGGCAGTGGACGATCTGCTTGACTTTGCCACGACGCAG