Description :
From Genome Similarity Track
Location :
Scaffold_175:54535- 55695
Transcript NameFunction/comments
Phyta_totarag5087conserved hypothetical protein

Sequence
1160 bases(100 bases per row)
GATTCCGTCGAGAGActacgtcgtcgtcctgaGGGCAGGAAATAGTCTTCCAACAGCTCCACTCGATCCAGATATTCCCCTTTGATGTGTTTGCCTCTGC
TGTCGAAGTAGAAGGCGCAGTCGTCattctcctccagcatgcGGCTGTAGAACGCCGAGAGCATGCGACTACCAGAAGAGGCCGTGGACTTGttggactg
cagcaggaaggcgTCCCAGCTGTGATCACAGATATGTAGCAGAGGTTGTTAGAGCAATGGTCAGTTGATTAGAGGAGCAACCAACAAACGCACTTGACgg
ggtcgtcgtcttcgtcatcgaggTGTtcgcagctccagctcttctgcaGTCGGTCTAGCAGCGAGTGGTCGCTTGGTGTGCCGTCTCTCCGCTGTCTGAT
CTCGCTGAAATCTGGTGGTACAATGTGGCAATCCTCAGTGTCCAGCCAGCACATCCTAAAGACTATGGACGGCAAAACAAACCTGGTTCATGGTTGCCGA
AGCACACGAGTACTGCTCCCATCGTCGAATATTGGCAAGTGACCCGAGAGGCGCAAGCGGCCGGATTGAGGGTTGGGCGTTGGTTGCGTGGAGCGGCTGC
CAGTTAGTcaggcagcttcaacgtcatcgTAAAACCTAAAACAAGGAAACGTCACGGCCTAATATAATATGTGCATAACCCCGGCGCAGTGATTTCTTTA
CCTTTGTATTTCCGTGGTAGGTTACAACCACATACGAACCCAAAGTACAGAAGACAGATTGCCCAAGCTTTTATCGACGCGATCCAAAACTTCAGAGTCC
TCCCCCATGCAGCTGTTTCCTTTTCTTGTGAACGGTGGATGGCGTTGAGCGCGGCAGTAGTTACCGACCGCTCGAAAAAAGAAGCCCCCACCAGTTTCAC
CATGGGAATTTATAGTTTCAAACTTAAGCGACAAGAGTAACGTTAGTGAAATTCCGTACAGTATAGCAGCTGACTTACAGGTTTACCAAAATAAATTCTA
ACCAGGGAGATGACACAAGAAACCTTGGACTCTCGTGCATGTACAGATAAGCTCGTAGCTGCCGTCTATATATATCAATCATATCGACAGCTtatacggt
acatgtagtatgtATGGTGGATAAATTCATGTTAGAATTCGGACGGACTCACACAACCAT