Description :
From Genome Similarity Track
Location :
Scaffold_49:5453- 6806
Transcript NameFunction/comments
Physo_538238PREDICTED: probable nitrate excretion transporter 6-like
Physo_538248Hypothetical protein

Sequence
1353 bases(100 bases per row)
CGTAGTTGCGTCTCCCACCGTCGAAGACATCCTCCATGAACTGCGCGTCGCGGCTCACCAACACGCGACCGCTCTCGATCTCCTCGAACCGATACGCCTT
CTCGTGCTCCGAGTACCCGAGGAAACGACAGCGCACCGACCGAGCGTCGAACTTCGACCGCTTCTCCTTCGGCACGTGCACGTACGCGTGGCACCCGAAC
ACCTTGAGGTTGGCCAGCAAAGGCTTCTTGCCGGTCCAAACGTGGTGCGGCGACTTGTCGTGACTGATGGCGCGCGTCGGACACCGGTTGCGGAGGAACG
TGGCCGTCATCACCGCTTCTCCCCAGTACTCCTTCGACAACCCGGCGTGCTCCAGCATGCAGCGCGCACACTCCACCAGCGTCCGATTCATTCGTGTTGT
CAAGACTGATGTGACGACGCCCCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAGGTCGGCGTGACCTTCACTGTGTGGTACCGAAATCATTCA
GGTGATTACGGGACGATGATTACGTCACGGTGATTACGCCAAGATTGTGGGTACAAGATGGGCATCGACGTGGCGTTCTCTGATTGGATAAGGTAACTGT
GTATCCAGTAGAGAATCCAGTAGGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCACGCGGTTGCGAACTAAGGACCTGAATCGAATC
ACTTTGCATTTTGCCAACTACTGCTCAAGTGCTCTTCCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGACCAAGACCCCGACTACGCCTTCGCCATG
GACGCCGCCCCGACCGCGACCGCCCGCATCAACAAGTTCGACGGAACCAACTTCCACACATGGAAGTTCAAGATGCAGATGGTGCTGGAGGAGCGCGAAC
TGTGGGAAGTGACGAGTGGGGAAGTGAAGCTCGAGCAGTGCACGACCGCGGCGGACCAAGCGACGTTTCGCAAGAAGTCGCGCAAGGCGCTGGCGATCGT
CTGTCTCGCGTTGGAGGACTCGCAGCTGCCGCTGGTGCGGTCGGCGAAGGACGCGCATGATGCATGGTCAAGACTCGAGGGACACTTCGAGAAGAAGAGC
CTGGCGAACAAGCTCTTTCTTCGTCGACGGTTCTTCACGACAACGATGGACGAAGGTGATGATGTGCTGGAGCACATTAACAAGCTCAAGACGCTGGCGG
AACAGCTCGACGCGGTCGGCGCTCCGGTCAGCGAGGACGACTTGGTGATCACGCTTCTTGCCAGTCTGAGCGAGTCGTACCAGTTCCTCATCACGGCGTT
GGAATCGCGCTCCGACACGCTGACGTGGGAGCTCGTGACGTCTCGGCTCCTGC