Description :
From Genome Similarity Track
Location :
Scaffold_386:5453- 6494
Transcript NameFunction/comments
Aphas_H257_19052Major Facilitator Superfamily (MFS)

Sequence
1041 bases(100 bases per row)
CTACTACTCCAGTATAATAATAGTACTCTGTACCGGATACAGTTTCCATACACCAGAGTCGGCTTCTGGCTACTTTGAATACTACTCCGTCCCAAATTAC
CTCCACGTTTCAACTTCGACTCACCTCAAAATTTGACTCATGTACCCAATTTCTACGAAATTTGTACCAATGAGAAGCTGGGAATTCAGTGTTTTGCTTG
CTCATGTTTTTATTACAGGTTTGTTGGATAATGTGCACACTGTCATCAAAATAATATTGCTCCTCAGCGCAGAATTAAAATCACTCACCGGACTTGATTA
ATGTATGGTCAAATGGGTAACAATATTCATATACAGAGGTAACGTAAACTCTATAATTGTATTATCTTATATGAGTACTCCTCGCTTGGGTTCTGCTCGA
GTCAGGTAGACATCCCTGCCATAACCATGGTGAGATTCCTCGTCCTCTATACCGACATTGCCCATGTAAGAAGTTTGGGCCAATTGGCTCGACCACTTGC
TTGTTCACAAGAGGCAGTTCACGCTATACAAAGATCACCAGTCTGATTTAAGAGAAATTTAAATAAATCCTCGTAATAAAAATGATTTTGCGGCAAAACT
AGAGGTGAAACGTGGAGGTAATTTGGGACAGAGTAGTACTTCGTACAGTACTTAGCAACCAGTCACGGTACTTACAGTTAGTAAGCTTACTGGTATGTGC
GGCTTCCAACGATGATATGCTGTCCGTGCCTTTCAAATCAAGACAGTACCAAGGCCAACTCAACTCGAACCTCGGTTTGGTACGCGAAATTCTAAACGTT
AAACTCAAATATCTCTGCCGATGTCCCAGAAGCCTTGCCAGCTCGCATTAACGCAATCTTGGACCACTCAAATCCCTTCAACAACTGTTAGCATTGCAAA
ACCACGTGGTTTCACAACAATTTCCACATCACGACATCGAACTTCCACGTTCAAGTCGCCTTAACGTCAGGCTAGACGATTGGAGGCAAAGCGACAAAGA
TCATTCATTTTCCACATCCTTCTACTTGACCACCATGGCAG