Description :
From Genome Similarity Track
Location :
Scaffold_17:545055- 550124
Transcript NameFunction/comments
Physo_156391hypothetical protein
Physo_113912hypothetical protein

Sequence
5069 bases(100 bases per row)
GCGCTGAACCTGCAGACGGTGGACATCAACGCTGTGGTGCGCGAAGGAGCGCCGCTGCTGCGCAGTGGAGGAGAGGTGGGTGCCCTGAGGCGGCTGGATG
GAGTCTTGAGGGGCGCGTAAATTGACAAGTGTGTGATACTTGTGCTAGTAGGAGTACCAGTATGCCACCAACTTGACGGAGGAGGAGCGACGTATTCATG
CCGTGAAGCAGCGACGTCTGCTGTTGAGACGACTTAGTGGGGCTGGAGGACCCATTTGGAAGACCCGAGAGGACTCGCTCACGAAGCAACTGCTGCCTCG
ACTCAACCAAGATCGTATGTGCGGCGGGGCTGCTAGACTACGGTGAGCGTTTTAATGATGCTGACTATTGTGCGGGTGTGGCTTCATTGTTGCAGATGCA
AAGGAAATCGCCGATGATATCGAGGCGAGTGAAACACAGCCGAGCGTCGCTAGCGAACCTGATGCAACGGAGAACCGAAAGCAAGCAAGCGAGATGCTGG
CTATCCCAACGAGATCGAAGCGTCGTCCTGCTAACGACACGGATGGGCCGGGGAGTGATGAGAAGAGGGTGAAAGTGGATCACACCGACGAATCCGAGGA
CGTCGTCATGGAACAAAGGGGTTCAGCCACAAGAGCGGACGAAGCTGAGACGCAGACTAAAGCTTCGATCGTGGCAAGCCTGGTCTCTGATCTGTTCGAG
AGTATGTTTGATTCCAAGTGGGAGGTTCGCCACGGCGCAGTTTTGTCGCTGCGTCAGATTCTACTGTCTGTGCAATTCACCGCTGCTGTTGAAGCTGCTC
GGCCAACTGAAGACGTGAGTGCACAGCGGAGTTTCGTGGACAAGTGGCTGGAAGAGTGTTTGATCAGGTGCATTTGCGTTCTCGCTCTGGATCAATTTGT
GGATTATTCGGCGGACGGGTCGGTGTCGCCCGTCCGAGAGGTTTGCGCGCAAGTCTTTGGCATTTTGCTTGGAAGCCTCTCGAGTGAGGAGACGCTGGTC
GGGTATTTGCAAGTGGTGCGCACGTTGTTCAGTGGTTCGACATGGCAGGCTTGTCACGGTGGCCTTCTGGGGCTGAAGTATCTTGTGCGAGCCCATAGCA
ACCACGCCAAGGTTCTCGTTCCTCGCTTCTACGACGATATCGTGACTGCCTTTTCTCAATCCGATTCGGAGGAAGACGTGCTAGTTCTGGCTGCAGAAAT
GTTTAAAGATTTTGCGCCATACTTGGATCGAGTTGAGGATACAGGGATCAAGAAAGCTGCTCAACTGCTCTGGGGGTCTCTAAAGCTGCACGAAAAAGCT
GGTCTAGTGAGTGCAAGCATCGTTGAAGCATTAAGCGCCTGGTATAACCACGCCCCCGTGGCAACCGTTTTGCAAAATGACAGTGAAGTCAGTCGTTCAC
TGTGGCAAAATCTGTCGTACACAGTCCCGATGTTGCATCACCATTCGTCGTCAGTTCGAGCATCCAGTGGAATTTGCGTCGCAGCCATCTTTTCAGGGGA
GGTTTCGTGTTTCAGTTCGAGCTCGGTCGACTTTGCTCGAGTTTTTCTGCCACATTTGCTGCTTCAGCTGCTGCTGGAAAAGGACGAATCGGTCCAGCAA
AGTCTGCTTGCTGCGTGGAAGAAAGTGGTGAGCAGCCTGTCGGAGGGTGAGATGCTGATGTCTATCATTGCAGAGCCACTGCTAAGATGGACGAAGCTCT
TGTGGTCGACAGACGACATTAATTATCTAAACGTTGACATGTCTACCTCCGAAGGCTCGGTATCGGATACATCGGTGTGCAATTCAGCACACCGGATCGC
TCGAGAGAATATGTCTTCGCGTGTGGCGTTCGCGGAAGCGATTGGCTTTGTTTTGGCTCACGTTCCTCTCTCCGGTGCGTGCATGACTGATCTAGTGAAG
CTGTTCCGAGATGGCATGAGTAGTAGCTCAGGTGCGCGACAGTGTGGGATTTTGCTAGCGTTGTCGAAGTGGAGTTGCTTTGAAAAGCAGTTGGCACAGG
AAAAATTGGACACACAGTCACAACGAGTCCAGCATCTCTTGGATTCGATGGGGCCCACACTGAGCTCGTTCGCGGGGAACCAGTGGATAACGCTTCACCC
TGACGCAGTGAGCGACGGAAGGCCGGTCTTCTACAGTGAACAACTTGGATCACTAAAACGCGTGAAGCAGATGGAAGCTCGAATCGTCGAGATATTATCC
GCCGTGGGTATCTCGGTACAACCCGCGGGGCGACCCGATTCAGCTTCATCAGCAGACATCTCACGACAGATCGCTGAGCACGTTGCTCTTTTCCCGTACG
ACCAGTTGCAAAACCGCCCGAAAGAATACGAATCCGCCCACTTCAAACGACAAGATCTCTTCCTTGTGGACGAGCTCGTTCAGCAAAGTTTTTCTCGCTT
TTATCATCGGATACAAGGACTCGGGAGCAGTGCTTTCTGTGAGCTACTGCCGATTCCCAAAAAGAGTGGATTTCTAGTTAAGGCGTTGATGAACTCGATC
AAGGAAGAAGAGGAGCAAGTGTTTCGCACTATTTCGTCCCAAACAATCGCGAACTTTGTGGTGGACCAGGCACACGTTCAAAAGAAATGTGTATCGAAGA
TTATCTCAAACCTGTGCAACAGTGCTGGGGCCTTGGTAGGTCTCCCGGGTGATCCTTTCGATGACATTCTTGGCAGCAGCAGCTCACCTGACAAGGAGAG
TGATTCAATTACCCCGGAAGTTCTCAAGAAGACCAAAGTTCGAGTAGCTGGAGCAGAGGCGACTCTGCGCCAACTATGTAAGCGCGCTGGTGGATCTCTT
TTCGAAACATGCAGTGCATTGGAGGACAATATTTCCAAGGCGTGGAACGAGCCAAATGCCGACGTGTTGACTATTCAACGAAGCATGCACCTGATCGTGT
TGATGATGTCCCATGTTGAGAGTGGGGCGATGCCAACCTGCTTGTCGTGGTTTGACCAACTTGCGCAATTGATTCAACGACCTTATGATAACCATCGGAC
GCGGCGGATTGTGGCGCATGCTGTCGCTACCATTTGCAAGTACGCGCAAGGAGAGCACCGCGAGAGTGCTATGCTTGTTGTGTATAACTCGATTTTTGTA
GCGTTTACACGGACTGGTAGCGTCGACGCAACAGAAGTACTCGAAGGTGCTGTGATGGTACTCGATCGGATCGTCCACAGCCTTGGATCCGACCTGATGC
CGTATGTTCCTAGTATGGTTCATTACGCGATGAAGACTATGAGCTCCCAGTTCAAACTTGTCCGCACTCTCGCTGCTGGGGCTTTTGCGGACCTGGTGCC
GCTGATACCACTTCAAATGGACCTGGAGCTTCATGACTCTAACAAGCTTCTCCCAGACGCGCTGAGAACGATTGTGAGCCAGAACGCAGTTTCTCGTACC
TTCCTTGAGAGCTTCACGGAAGGGAAAGCTATTCAGCACGTCGACGTTAAATCTTGGCTGGCTCCAGATATCTCTATCCGTGTGTACCAACAGCACGGCG
TCGATTGGTTGTGCTTCATGGCTAACAACAATCTCCACGGAATTCTTGCTGATGATATGGGCCTCGGAAAGACACTGCAGTCGCTTTCTGCGATGGCTGC
AACGCTCTCGATGTCCTCCTCTATCCTCGAAGAAGGCCGTGCGTGTCTTATTGTATGCCCGCCGATCATAGTTCACCACTGGATCCAGGAGGCCAAGAAA
TACCTGCCAGGGTTCTTTGAATCTATCATCGACTACTCGTTGCCAGCTAGCGAGCGAAAGGCTCTGAATCGCAAGGGGGGTCTGCCAATATTGGATCACG
GGCCGACATTGATCGTGACAACGTACGCGATCTTGCGTACAGATATCGAGTTCTTAAGCGGTATCGACTACTCTTTTGTGGTGCTGGACGAAGCACACCT
AATCCGGAACCCTTCGACTGCTCTGTTTCGTGCCGTGCTCGAACTTCGTGCAGTTCACCGAGTTGCGTTGAGTGGAACACCGCTGCAGAATAACGTCACC
GACCTGTGGGCGCTGTTCGAGTTCCTGATGCCAGGTTATTTGGGCGAGTTTGTGGATTTCCGGCGTGAGTTTGTTCTTCCGATCACCAAGTCAAAGGAGC
GGAATGCCACAACAAAGCAGAAGGAGCTAGCGGCAATCGCTATCGCTCAACTGCATCAAAAAGTCCTGCCGTTTATTCTACGACGAACGAAAGACCAGGT
GCTGGAGGAACTTCCTCCAAAAATCATCTCGAATGTGCTGCTGCCGCTGTCGTCACTGCAGAAGCGTCTCTACTCTCTGGCGTCGTCAGCTGAGACAGAA
GCAACGGCGTCCTCGCGTTCGACTAACGCCAAGAAACCCGATACGAAGCCGTTGACGAACGTGCTGACAAACCTCCAACTTTTGCGCAAGATTTGTGTCC
ACCCCGCGCTTGTTGCCGACAACGCAGTTACTCGAGGTCTCAATTCGAAGGAGATGAAGGCTCTTGGCGACTGGAAGAGCTCTGGAAAGATGACGGGCTT
GCGCGATCTCTTGGTTGAATGCTGCGATGTTGCAGCGTGGGATCAGGGCAGCCGCGAGGGCTCTGGTGCTGACGCTGATAACCTCGACGAGACCAACCTG
TCTCCTCATCGGTGTCTGGTATTCGCGCACCTGCAGAGAACACTTGACCTCACCGAGCAAATGTTGCGAGACGCTTTACCTGGAGTTACCTATCGGCGCC
TTGATGGCCAAACGCCTCACGCCAAGCGCGCAGATATTGTGCAGCACTTCAATGCTGATCCATCCATTGACGTTCTGCTGCTGACGACGTCAGTGGGCGG
CCTAGGGCTCACTCTCACTGGCGCTGATACGGTAATCTTCATCGAGCACTCGTGGAACCCCTTTGTCGATCTGCAGGCCATGGATCGTGCGCATCGCATT
GGGCAGAAGAGAACTGTGCGTGTGTTCCGGTTGATCATGGAGGAGTCACTGGAGGAGCACATTCTGAATCTCCAGGAGTTCAAGGAACAAGTTGCAGCTA
CGGTGGTAAGGAAGAGTGACGCGCAGACGAGTATGAACACCAACACGAAAGGTGTCCTCAACTTGTTGC