Description :
From Genome Similarity Track
Location :
contig_128:54501- 59626
Transcript NameFunction/comments
g13578.t1hypothetical protein
g13579.t1ETO60996.1 hypothetical protein F444_20900, partial [Phytophthora parasitica P1976
g13580.t1OWZ14690.1 Mitochondrial Carrier (MC) protein [Phytophthora megakarya

Sequence
5125 bases(100 bases per row)
GCCGCTGTCCACGTCCATCGCGGCCACCGGGTAGTCCTGGCGGTCGCCGTCCTGGACACTCGAGTCGTCCTTCGTCTCCTCGTCGCTCGTCATCTCCGGC
GGGAGCACGCGGTGGCCGATCCGGAATGCCACCACGCCGCGTGGCAGTGGGGGTCCCCAGCGGGGAGCTGGAACCTCGCTGAGGCGGGCTGCAACACGGC
CTGCCACCAGCGTCCTGGGTAGGGGCGGGCCCCAGCGCTCGCGGGCTTGTTGCTCGGCGTGGTCCGGGTCGACGACAAGAGCGGAGCTCGCTAGCGGGGG
GTCGCTGCGAGCTTCGGGGGGTCTTGGCGGGGGGAGTCGGGCGTGACAGTGGCCGCCTTGACAGTGGCGTTGGCTGCACCAGCAGTGGGGCTCAATTCCC
CTGCTGCCGGCGCAGCCGCTGCCGAGAAGGTGCGGTTGAGGCTGGCGCACGCGTGTGCGTGGTTTGCAGCAGCCAGCCTCGACGCGAAGGGCACACCGCA
CGCACATCCCGCCGAGAACCGGTCGAGGAAGGCAGTGCGGCGGTGCCGGGAGTCCCGGTGTCGCTTGAGCGACGCGAAGCTGGCGGCCGTGTACGTGCAC
AGCGTGCACTGGAAGCGCTGCGCATTGTGCGCGTACACGGAGAGGACGGAGGCCGGGCGAGCGCTGGCCGCGGATAGCCTAGGCGCTGGAGCGTGGTCCC
CAGCCTCGTCCTCCTCCTCGAGCAGGAGCTCGGCCAGCTCGCGGGTGTCTTCGTCGTCGACGTCGTTGAGACGTCGACGCTTGCCGCCGACGCGCTGCCA
TGGCGGCTGCTGTCGGCGGGCACCTTGGTCAACATCCATGGCGACGACGCCGACGTCGCCTGCTGCATCGCTGCTGCCTGCGCCGTCGTCGCCGTCGCCG
CTCGCGTCCGTCGTCCTGCTGCTGCCGTCGCTGCTGACCACGTCGCCCGACATGGGCTCCACGCGCGCGCTAGCTGGGGGTGCTTGTTCTTGGGGCGGCT
CGGCGCGCGCGGGGCTCCACGGCGGCGCGGCCAACAGGAGAGGTGGCAGGGGCAGCTGCGACTGCCGTCACCAGTGGGGCGGCAGCAGCCGCAGCTGGGC
TCGGCGGCGGAGCGCTTGGGGGCGGCGGGGTGATGCCTGGTCGGCGAGCATGCGCCCGCCCTTGCGGGTGAGGGCAGCACATTCGCGGGGGATTCGGGGG
CCGGCGGCCCGTGCGCACAAGCGGCGGAGTTGCGGGGGGCCGGCGCCGCGGCAGCAGCGGCTGCGGGCGTCCAGGGTGACCCACCGGCGGGCAGCATGCA
TGCCGCCCTGCCGGGTGGGCCATCATCGCGTGGGAGGTCGTGGCGGCGGCTGGCGGCGGCGGCGCGGTCGTCCGGCGCGTCCTCTTCGTCGCTGTCGTCG
TCCTCCAGCTCGCTGGGGCCGTACGCGGCCGCGAGAGCGCGAGCCGTGGCGGCTGCTAGCACTTCCCCTGGCACGACCGGCTCGGGCAGCATGCCGCTCG
CCCTGCCGGGTCGTGCCACTTCGCAGGGGGGGAGCTGGGGCGCGGCGACGGGCGGAGAGGCGGGCGAGGGACCTTGGCCAGCCAACGGGCGCGCGTGGGG
GGGCGGCGGACGTCTGGGGCCGTCGTGGCGGCCGGCGCTCGGCGGCGCTTCTTCGGCGGCCGGCCGTACGGGCTGAGAAGGCTCCGTTTGTGGAAGCGTC
GCCCGTACGGCCTGAGAGGCCAGCATTCGGCCGATAGTGGGGCCGAGTGGGGAGGGGTGCGCCGACCTCCCGCCCGCACCAGCGGACCGTCCACTGTCGC
CAGCGGACGGTGGATCCACCCGTGGATCCCCGAAACGACGCGAGGTCGTGGAGGCGGGGCGGGGCGTCTCTTGGCCGGCAGCGGCCTCGAGGCGCGTGAG
GGGTCGCGGTGCAATGGGCGCTGCGGGTCCCGGACCCGTGCCCGAAGTTGCAGCCGCTGAAGCGTCGCCGGTGCCGAGCAGCGGCACCGCGCGTGGAGGC
TCTCGGGGTCCGTTTCGGGCCCGGAAAGGGCCAAAACGGGGGCGAGCGGATCCACAGTGTGTAACCGCACCCCTAGTGGATCCGCCCACCCGTCCACTGC
GCCACCGACCAGCCCACTCTCGTCACCGACCGCGCTGTAAAAAGACGCGTCGCTGGCGAGACTGGATTGGCTGGCTGTGGAGCACTCGCTGTCGGTGGAC
AGTGAGCGCTCCCTGATTGGCCAAAAGAACCGCATCGCTGCGATCCTATTGGTCAAAAAGGGTAAAGGGACAATGGAGGACGCAACGCGGACCGAGGAGG
ACAGCCGAGGAGGAAAGGTAGGTAGAAAAGAGTCAAATGTAGTTGGCCTCGCGGGGGAAAGGTGAAAGCCCCCGGAAACCGTCTCGCACAGCAAGCGCCA
CAAGAGCCCAAAAATGAATGTGAAAAAGACCAACGAAAAACGTCGGAAACCAGTTTTCACACTGATTAGAACAGATACTACACTTGATCTTAGCCAAAAG
GCCGAGAAGGTATGATTATCGTTCTAGATAGAGCTTTCTCCTTATAGTAGTTTAATACCCTCACGAGCATGTGTTTGTTTAAGTATATTATTATTCTCTA
ATATATGGTAAAATAGCATACCTATCCCCCTACCGGTTTTTTAAGAGTGATTCTAGCCTTCTAAGAAATTAAAATTGCGATTATAGTCTACATTTTCGGT
AGCTGGGCTGAAGTGCTGCCAAACGATGCACCGCAGCTCCTTCCTCTTTGCAGCTCGAAAGTGCTGTTCCAAAACCCCGTACGCTATCAAACTACACATT
CCTATGCAGTCAGCCCGAATGCAAGAAAGTCAACCCCTGCATCGCTCGCTAGTCGCCCGCACGGGTACCTTCCTTAATAATCACAAACCAATCAGACGCC
TCGTTCCTGCCAAACAGTTTCAAGCAGATGTCGGAGAGAGCGGAGCGACTCTCGGGCCTGCAGAATGGCGTCGTGGGCTCCATCGCCGGCATGATCGAAG
TGATTCTGCAGCAGCCTACTGTGGCCATCAAGAACGCGGTACAGCAGGGCCGCCCCATCGCGTGGTCCGCGCCAGCGCTCTACCGCGGCGTGGGCGTCTC
GCTGGCATCCATTGCGCCCGTGAGCGCCATCCAGTTCGCAGTCAACGGCCGGTTGCTGCGCGGCCTCACAGCCCGGGCGCGGCGCCATCAGACCAGACGA
AGGTCCTGTGTGGCACGCTGTCGGGTGTCGCGTCGGCGGTGCTGAGCGCCTCCGCGGAGCTCGTCATGACGCTGCAGCAGAACAACGGCAAGAGTTTCGG
CGCCACCGTCAAGGAGGTGGCCGGCAGCACGGCGTGCGCGGCTATTGCGCGGCTTCACGGTCACGGCTGTGCGAGACGCCGTGTGGTGCGCCGGGTACTT
GGCTCTGGGTCCCGTGTTCACGCGCGAGATGCACACGCTGAGCCCCGCCACCTTCGGACACGTGGACACCGCCACCAAGTCGCAGAAGGCCTCGGCCTCG
ATCGCCGGCTGCGTCACCGCCGGACTGATCACCGTGGTGGCCACGCAGCCCGTGGACACGGTCAAGACGGTCATGCAGGGCGAGGCCATGGCACTACCTG
CGGGTCGCGCACCCAGCTCTCTCGCCACCGCCGCTCGCATCTACCGCGAAGGAGGCTTGGCGCGGTTCTACAGCGGCATCGTGCCGAGAGGATGTCGCTT
GGTCGGTGCCGTGTTTATCCTGGGCCAGGCGCGCATCCGGCTCGAAGAGGTCTTCGAGGAGCACGAGCTGCTCAAGTTCTAAAAGCACGTAGGCGCACCA
TAAAGCGCTCGGGTAGATGATAATCCAACGAGCACAACACGATTCCAACCAGCGGCGCCAGTTCTCCATTGATGTGGTGTCAGTAGTCGAACAGCAAGTG
ACGTGGTTATCTTGATGCAGCGATTGGACAAGTGCACAAACAGCTGCAGGAACTTCACTTTGAGGTCACTTGCAGATTCGCGGCCAAGATGACGGAGCGG
GCGCAGAGACTCACGGCACTGCAGAACGGGGCCGTGGGGTCCCTCGCCGGGATGATCGAGATGACGATCCAGCAGCCGTGGGTGGGCGTCAAGAACGCTG
TGCAGCAAGGTCGCGCCGTGCCCCGATCGGTTCCGGCGCTCTACCGGGGCCTGGGGGTGTCCCTGTCGTCCATTGCGCCCGTGAGCGCCATCCGCTTCGC
CATCAACGGGCGACTGCTGCGCGTCCTGAGCGGGACCGACTCGGCACCGACGGACCAGGTCAAGGTACTGTGTAGCACAGTCTCCGGCGCAACGGCCGCG
GTGATCACGGGCCCGGCGGAGCTCGTCATGACACTGCAGCAGAACAACGGGAGGAGCTTCGGCGCGACCGTGAAAGCGGTGGTGGAGACCCACGGAGCCT
CGAGACTCGTGCGGGGCTACCCGGCCACAGCTCTACGCGACGCCGTCTGGTGCGCCGGCTACTTGGCTCTGGGGCCGCTGTTCACGCGCGAGGTGCACGG
CCTGAGACCTCAGACGTTCGGCCACTATGACACAGCTACGACGTCGCAGAAAGCTTCGGCCTCCATCGCAGGATGTTTGGCTGCTGGACTCGTGGTGGTG
CCTCTCACGCAGCCAGTGGATACGATTAAGACAGTGATGCAGGGAGAGGCCATGAAACTGCCATCGGGTCGAGGACCTGGTGTGCTCGCCACGGCCAAGC
GCATTTACAGGGAAGGAGGAGCTCGGCGATTCTACCGCGGCATTGTGGCGCGTGGAAGTCGCCTCGTTGGGGCCGTGTTCATTCTCGGACAAGCTCGCAT
GCGGCTCGAGGAGCTCTTCGAAGACCACGATCTGCTGAGGTTCGACGTTGGCGCCAACTATGAGCCGTGAGTGACGGAATGAAAGAGAACACGCACCAAG
GAGTCAGTCGTATCCTATGGCAACTCGCTTCTTGCTGCGTGCCAGAAAGCATTTCGCAACAACAGTGGTTTGCTATTGAGTGTCATGTGCCTAGTCTGTT
TTCGTGTTTCTTGCGGCTTACGAGAGCGTGCAATGGCATCCTGCCACGCGAATCATTTGTTGCCCTGATTCCTCTGCTGGCGGTGTGGCCTGGTGCGGAA
GTGTGACGCGAATTTTGCCGGTGAT