Description :
From Genome Similarity Track
Location :
Scaffold_221:5450- 9580
Sequence
4130 bases(100 bases per row)
ACATAATGAGAGTCAAATCTCATAGGTAGGCACACGATTAAAAACCTGTAAGTTGAATACTCTGATTCTCCATATTCTCTGCGCGGCAACCGGAACGGAT
TGACCACATTTGCCTATGTGTCACTAACCTGACTATACGTGCTATACGTGCTATACATGCAAATCGACCGTGATCACAGAATCTGGCTCTCTCCCAATCG
GGCACGATCGGTGCCTCGTCGGGCACTATTATCTCGTCACAGCGACCTGCAGTCGGGCACAATAATGCGTGACATAATCTAATTATGTTGTTGCTTTTTC
TGGGATAGCGCTAGCTACGTTAGTAGCAGCTACTGCACAGCCTCATATCTGATTATTAGTTAATGCAATACGCCAATATATTTGAACACTTCATTTTGAG
CAGTTTATTTGTGTGGTGACAAAGATTCCTGTGTAATACACTTCGATTTTGCCCAATTTAAGTAGGACGCCCTTTGCGTCCGAGTATTTGGGAGGGTTAA
ATTTGGTGCAATACAGGTATCGCCGAGTTGACCTTGCAGGTATTAGCCAAGTATTATCAAATGCGCATAAAATAGACAGAAAACGCGGTAATTTACGCGC
AAATTACGAAACAGGAATTTTCCAGATGGGTTACCCCTGGAAAATCCGCATGTGTGAAAGTTTGACCAAAGCGAAAGTGATGAGGGCACCGCTTTGTCAG
CATCTAGCTAAAACCACCCTGTGTTGAGCTATTCAATCAGAACACGGCTTAACCTTCAAGTACGCTCACACATATATCCGGGTATTCACCCGGTTTTGTT
CCTGTATTAGTCGAAGGTCGCCAAAGTACGTTATCTCAAGCTACGCAGCAGTGATCTCTCATTTGAAGGACCAAACTCAGCACTTAACGCCAGAAGTGGA
GGCAGGTAAAAATGCCGCAACTATCTGCATCCTTTTGCCGCGGGACCTTGAAGATGGTTTGCTTGTACTTCTCTTTGAATACGTCATTGTTCACCTAAGT
AGCCATCGCCTTCAACAATCGAGATGTCGCCCTCTTGTTCATGCTGTCATATACGACTACCGGCTTGGTCCCCTCAATCACGACAAGGCTAGCTCAGTGG
TTGTTGTCAACGTTAACAGGCAGGAAGACGTAGTCGTTACATTCTCCATTCACCAACTCGCGGAACTTGATAATCGTTTCAGCGGAGACAAtctcttcat
catcactgaAGAGATGATGCATGAATAGCGTCGAGTTGGTTTTGATGTTCTCGCGAGGAAGGTCGTGAAGGCACGTATCGATGCATCGCTCATCCATGTT
TCAGCAAGGAATCGATCAAGTTCACCATACATAATTCCCAAACCAGGCACGTTAGCGTAGGGCCATGTCGTCAACAgttcttcagcaacgcgGCCGATCA
TTGCATGGTCGCCGACGTGCTCCTTCACTGCATTGAGAAGCcttgcactgcactgcactcCGAATATGTAGATTTGCTGCATGTTCCACTGTCACTTCAT
CGCTTCCAACTGTTGTCGAGTAAACTTGCCGAGCTTTGCCGAAGCTACCACCACAGAATCTGCGCAGGTTTCTCCATATATTCCATTATCATCTGCAATT
GGGTTTCCTTCCTTAAGTGAGCTTTTCTCTTTCTGTAGGTGTGCGAGGGCTTGATCAGGCGTTGTTTCGGGAAGGCGATATCCGCTACATAACTCGGATC
TACCTGCCATCTGAGCGGCGGTAGTGCACTAGATTCGATAACTTGATGTGTGGACAAATACGAGTCTATATCTTGCAATGTGGGTTGAATTTCCTCGAGA
CATACCACCACATCACACACGCCCTTATCGCGGAGTAGAACACGCAAACGCATGCCGTGGTGGTACTCTTTCAAAGCGGCACGAGCCTTCATACGCTGTT
CCTCGCGGTTTACTCTCGGCCTCCCAACTACAGGCACATTGCCATTCAGCTTGATTATGACCTCTCCTATTTGATCGTCCGACTCAAGCTGTTCCATGTG
AGACGTAGCTAATTATGTCAGTGGCAACTGCTCATCATTCTCGTCTGTACCATGTTCAGGTGTGCAATCCGCAGAACCACCGCAGTTTCCTGCCGCGCCA
CCACGCCTCAAtcctgcttcaccaccatcgCGCGCTtcgctgccactgccgctgTCACCCTCTGGTGGATAGTTGTCACCATTGCCAGCATTGCCATCGC
CAACAATAGGAGTGACAATTGCCGTTTTGCCTTGTCGGAGATTGGACCACCATTCGTCAACCTGCAACATTGTGCTTTCGAACAAATCGTCCGATATCTG
AGCCAACTCCCCGCTAATCCGTCCGAACATTTGCTGCGCCCGCCGGTATTTTCACGCTCGCTCAATACACATCGGCGAGTCGAACTGGCAGCTTTGTACG
CTTTGGCTACAAACGGAGACGTCAGCTCAGTTGCACCAGGGAgcgtcggcgctggccaacCATCTAATCAAAATACACAATATACATGTTAGATAACTGG
GTTAACTTCGGCCCGCATCTAAATACCTGGCCACAACCTGTCCAATACCTGTATAAAACCTGGTCTTACCTGGGCTGAATTAATGCGAGCTGAATGATGA
ATGCGCTTCCGGTCGACTTCTTACTTGGATAGCATTGCGTGCCGACAGGGACATTTCATCGTCAGATAGAACTCGCAGTCGCGCGTCATTCCATCTTTCT
GCAGTAGATACCCATTAACGTTGTTACGCACCGTTACAGATTCGCCATTATCTGTAAAAAGGTAGCGCCACTATATTGATGTCGACAGCAAGTGGATACT
GAATCTCCAGACCTTCTGCAAAATATACCCCGTGATTATCCGAACCCGGATAAAAAGCAaacacttgaagctgaaggagggTCGAAGGTCATTTTGGACA
CAACATTTTCATTCTAGACAATGAAGTGAACAGGAGTCTTCTCGCGCAGGCTTCAGAGGGAACCTAAGAGTCTGCGACTACGAGGGGGCGCCTTATAGAT
GTTGCTGGGCACCCTGCTGTCCGCCGAAGTGATGCTGTCAACCTCAGCGGCGCCAGTAGTCGTCGTAGTGGTCGCAATACTGCCCACTGGTgttgctctt
cctccgttCTCTGAAACATCTCACCCGATACACTTGTCAAAAATAAAAGCGGTTGAGAAAACGCTACGTGTGAAAATTGCGATTAAGTACGAATTCCAGT
GACCAATCTTTGAGGCCATTTTTCCCGAACAACCCAAATGGCGTCTAAAcatcattttgtttgacgCTGTCTCATATAAGGTCTGCTCCAATTGGAGCTA
GCTGCAGAAAATCACCCACGAGTAATATATGAATCCCACCAAATTACACTTCCGGTACCCTTTTCACTTTGCGCAGCAGTTTGGCTGCCTCAATAAGCTG
TACTTTGTTCATCATTGAAATCTCATCGATGGCTATCATGCTCAGATTCATCACCCGCACCGATAGAATTCTCATGACGGTGTTGCACCAAAATCTTGCT
AACCAATTAATGTTGCCTCTTTTCCAGTTTGGGATGTCTTGGTGAGACTGTTCGAATGGCCCCGACTTCTGCACCGCGTTTGGATCGCATCAATAATACG
CCTTTTGCCTTTTCCTGTCCCCCCTTCCCCCctgagaagaagacggagttGATCAACTCTTAATTCATCTTTCATGTTTGCACCCCATATGCCATAGTCT
GATggttctccacctccttaATAGAGCTAGACCTGCTGTTTTGAAGCCAAACAGTGCTTTTCATTCATCGTTCATGCTCGTGATATTTCGGCAATGGTGG
TGAATGATCTAAATTCTCGTGGTGACTGCGTTCTATTGTTCTGCGACTGCCAGTCGGTCCTTGAATTTATTAGAGATTCGTATAACAACTCCATCACCTC
CGTGTTCTTCTTTTCAGCAACGGCAGGGGAACACGGCGCGAAAAAGTAAAGCATTATCGGTTGTAGGGTCAGAGATCCATTTGCACATATCACGCACAGA
TGCAAAACTCAGAGGAGGCTGTTCTCTACaagccaagctgctgctttcgtTGCTACCTCTTCTAGTAAATCAGGCGTACTAAAAGGTTTCATGGTATGAC
AGATGATCGAttcaggagctgctgtcgttg