Description :
From Genome Similarity Track
Location :
Scaffold_3863:545- 1979
Sequence
1434 bases(100 bases per row)
TGCAGATCTGGTGCGGTTTCTCACCTTTCTTGATAGCGTCGATCGCCGTGTCCAGCTTGGAGACGTATTCCTGGCAATACTTGTTGTCGCCCAAGAGACC
GCAGATCATGTCGGCGAACTGGCGAATCTGGCCCATGTCTTTTTCGTCTTCTTGGAGAGCAATCTCAAGCAGCGTCGTAAAGTACTCACAGTAGAAGCAC
TTGTTATCGCCACGATGTTGCTGCATCGCCAGCGACGCGACCGTCTCCGTAAACTTGGGGTTCGACACCCAACCGAGCATCTTCCATGATCCACGGTGAC
TCGTTTTCTTGCACATACCGATCGCCGTACAGATTTGCTCGGGGCTTTTGCCCTGCTTCGTCCAGTCGACAATCTTGCCGAAGTTGGTCGAGAGGTCATC
GCACTTGCAGTCCTTGGGGGCCAGCTTGCACACATACTTGATCACCGTGTGGAGAACCTCGAGTTGGCCCGGTGCATGCTGCACCACGAACGCGACAGCA
CCCGTAATGTGCTCACAGTAGAAGCACGCGTGATTCGACGACACTTCCACGGGTAAATCATCGGCGTCCGGCGTGGTCGAGTCGATGGACGCGGTGCACA
TCGTGAGCCGTACACAGACAACTTCCGGGTCGGTACCGTGGGCGAGCCACTCGACGACATCGTCGTAGCGCTTGATGAACGTGTGGCACATCGAGTCGGC
GCTCATCGAGTCACAAATGTCGCCGAGAATCTCGCGCACTTGCTGGACTGTGGCCATGTCCTTCTTGACGGCGTCGCCCACCATCTTGACAAACCGCTTG
CACAACTTGCACGACAACGGTGGGTCTTGGACGTCGCCTTTCATCAGTTCGTCTTTCATCTTGACCGCGTCGCAAATGACATCGTGGGTCTTGCCCGCTC
GCAGAAACTGCTCAATCTGGGGCGCCATCGCGACCACGCGTTTGCACTCTTGCGCCAGCGCCGTGGTCTCGAGGTCGTCGCAGCTCATTTGGCCTTCAAA
GTGAAACGTCACGAGACTGCCCATTGGCGTGCGCAGCCGCGACGTCATGCGCTGGGCCTCGCGGGTCAGCGCGGCCTGCTCGTCGACGCGCTGCACGGCG
ACGCGACACGCAAACGCCTTCTCTTCCTCACTCAGCACACCCTCAGTCGGTTCTTCCATCACCAGCACGACCACGGGCTCATCGTCTTGCGCTTCTTCTT
CGCCAAACGCCGAGTCCCAAAACTGCTCCAGCAGTTGGGTCGACTTTTCAATCTCGCGCTGCATCGTCGCCAAGAGGCCGTTTTCGCGCGCGATTCCGTG
CTGCGCCGCCACACGCGCGGGCGCCGCGATCGCGACGGCCGCCGCGGCCACGGCGAGCGCGCGGAGCGAGCCAAGCTTCATGGTTTCCTTGCGAGATCTT
CCGCTCTTCTCTTCTTCGCGTCTGGGTCCTCCTT