Description :
From Genome Similarity Track
Location :
contig_128:54495- 59623
Transcript NameFunction/comments
g14102.t1hypothetical protein
g14103.t1OWZ14690.1 Mitochondrial Carrier (MC) protein [Phytophthora megakarya
g14104.t1hypothetical protein

Sequence
5128 bases(100 bases per row)
TGCCGCTGTCCACGTCCATCGCGGCCACCGGGTAGTCCTGGCGGTCGCCGTCCTGGACACTCGAGTCGTCCTTCGTCTCCTCGTCGCTCGTCATCTCCGG
CGGGAGCACGCGGTGGCCGATCCGGAATGCCACCACGCCGCGTGGCAGTGGGGGTCCCCAGCGGGGAGCTGGAACCTCGCTGAGGCGGGCTGCAACACGG
CCTGCCACCAGCGTCCTGGGTAGGGGCGGGCCCCAGCGCTCGCGGGCTTGTTGCTCGGCGTGGTCCGGGTCGACGACAAGAGCGGAGCTCGCTAGCGGGG
GGTCGCTGCGAGCTTCGGGGGGTCTTGGCGGGGGGAGTCGGGCGTGACAGTGGCCGCCTTGACAGTGGCGTTGGCTGCACCAGCAGTGGGGCTCAATTCC
CCTGCTGCCGGCGCAGCCGCTGCCGAGAAGGTGCGGTTGAGGCTGGCGCACGCGTGTGCGTGGTTTGCAGCAGCCAGCCTCGACGCGAAGGGCACACCGC
ACGCACATCCCGCCGAGAACCGGTCGAGGAAGGCAGTGCGGCGGTGCCGGGAGTCCCGGTGTCGCTTGAGCGACGCGAAGCTGGCGGCCGTGTACGTGCA
CAGCGTGCACTGGAAGCGCTGCGCATTGTGCGCGTACACGGAGAGGACGGAGGCCGGGCGAGCGCTGGCCGCGGATAGCCTAGGCGCTGGAGCGTGGTCC
CCAGCCTCGTCCTCCTCCTCGAGCAGGAGCTCGGCCAGCTCGCGGGTGTCTTCGTCGTCGACGTCGTTGAGACGTCGACGCTTGCCGCCGACGCGCTGCC
ATGGCGGCTGCTGTCGGCGGGCACCTTGGTCAACATCCATGGCGACGACGCCGACGTCGCCTGCTGCATCGCTGCTGCCTGCGCCGTCGTCGCCGTCGCC
GCTCGCGTCCGTCGTCCTGCTGCTGCCGTCGCTGCTGACCACGTCGCCCGACATGGGCTCCACGCGCGCGCTAGCTGGGGGTGCTTGTTCTTGGGGCGGC
TCGGCGCGCGCGGGGCTCCACGGCGGCGCGGCCAACAGGAGAGGTGGCAGGGGCAGCTGCGACTGCCGTCACCAGTGGGGCGGCAGCAGCCGCAGCTGGG
CTCGGCGGCGGAGCGCTTGGGGGCGGCGGGGTGATGCCTGGTCGGCGAGCATGCGCCCGCCCTTGCGGGTGAGGGCAGCACATTCGCGGGGGATTCGGGG
GCCGGCGGCCCGTGCGCACAAGCGGCGGAGTTGCGGGGGGCCGGCGCCGCGGCAGCAGCGGCTGCGGGCGTCCAGGGTGACCCACCGGCGGGCAGCATGC
ATGCCGCCCTGCCGGGTGGGCCATCATCGCGTGGGAGGTCGTGGCGGCGGCTGGCGGCGGCGGCGCGGTCGTCCGGCGCGTCCTCTTCGTCGCTGTCGTC
GTCCTCCAGCTCGCTGGGGCCGTACGCGGCCGCGAGAGCGCGAGCCGTGGCGGCTGCTAGCACTTCCCCTGGCACGACCGGCTCGGGCAGCATGCCGCTC
GCCCTGCCGGGTCGTGCCACTTCGCAGGGGGGGAGCTGGGGCGCGGCGACGGGCGGAGAGGCGGGCGAGGGACCTTGGCCAGCCAACGGGCGCGCGTGGG
GGGGCGGCGGACGTCTGGGGCCGTCGTGGCGGCCGGCGCTCGGCGGCGCTTCTTCGGCGGCCGGCCGTACGGGCTGAGAAGGCTCCGTTTGTGGAAGCGT
CGCCCGTACGGCCTGAGAGGCCAGCATTCGGCCGATAGTGGGGCCGAGTGGGGAGGGGTGCGCCGACCTCCCGCCCGCACCAGCGGACCGTCCACTGTCG
CCAGCGGACGGTGGATCCACCCGTGGATCCCCGAAACGACGCGAGGTCGTGGAGGCGGGGCGGGGCGTCTCTTGGCCGGCAGCGGCCTCGAGGCGCGTGA
GGGGTCGCGGTGCAATGGGCGCTGCGGGTCCCGGACCCGTGCCCGAAGTTGCAGCCGCTGAAGCGTCGCCGGTGCCGAGCAGCGGCACCGCGCGTGGAGG
CTCTCGGGGTCCGTTTCGGGCCCGGAAAGGGCCAAAACGGGGGCGAGCGGATCCACAGTGTGTAACCGCACCCCTAGTGGATCCGCCCACCCGTCCACTG
CGCCACCGACCAGCCCACTCTCGTCACCGACCGCGCTGTAAAAAGACGCGTCGCTGGCGAGACTGGATTGGCTGGCTGTGGAGCACTCGCTGTCGGTGGA
CAGTGAGCGCTCCCTGATTGGCCAAAAGAACCGCATCGCTGCGATCCTATTGGTCAAAAAGGGTAAAGGAACAATGGAGGACGCAACGCGGACCGAGGTG
GACAGCCGAGGAGGAAAGGTAGGTAGAAAAGATGCAAATGTAGTTGGCCTCGCGGGGGAGAGGTGAAAGCCCCCGGAAACCGTCTCGCACAGCAAGCGCC
ACAAGAGCCCAAAAATGAATGTGAAAAAGACCAACGAAAAACGTCGGAAACCAGTTTTCACACTGATTAGAACAGATACTACACTTGATCTTAGCCAAAA
GGCCGAGAAGGTATGATTATCGTTCTAGATAGAGCTTTCTCCTTATAGTAGTTTAATACCCTCACGAGCATGTGTTTGTTTAAGTATATTATTATTCTCT
AATATATGGTAAAATAGCATACCTATCCTCCTACCGGTTTTTTTAAGAGTGATTCTAGCCTTCTAAGAAATTAAAATTGCGATTATAGTCTACATTTTCG
GTAGCTGGGCTAAAGTGCTGCCAAACGATGCACCGCAGCTCCTTCCTCGTTGCAGCTCGAAAGTGCTGTTCCAAAACCCCGTACGCTATCAAACTACACA
TTCCTATGCAGTCAGCCCGAATGTAAGAAAGTCAACCCCTGCATCGCTCGCTAGTCGCCCGCACGGGTACCTTCCTTAATAATCACAAACCAATCAGACG
CCTCGTTCCTGCCAAACAGTTTCAAGCAGATGTCGGAGAGAGCGGAGCGACTCTCGGGCCTGCAGAATGGCGTCGTGGGCTCCATCGCCGGCATGATCGA
AGTGATTCTGCAGCAGCCTACTGTGGCCATCAAGAACGCGGTACAGCAGGGCCGCCCCATCGCGTGGTCCGCGCCAGCGCTCTACCGCGGCGTGGGCGTC
TCGCTGGCATCCATTGCGCCCGTGAGCGCCATCCAGTTCGCAGTCAACGGCCGGTTGCTGCGCGGCCTCACAGCCCGGGCGCGGCGCCATCAGACCAGAC
GAAGGTCCTGTGTGGCACGCTGTCGGGTGTCGCGTCGGCGGTGCTGAGCGCCTCCGCGGAGCTCGTCATGACGCTGCAGCAGAACAACGGCAAGAGTTTC
GGCGCCACCGTCAAGGAGGTGGCCGGCAGCACGGCGTGCGCGGCTATTGCGCGGCTTCACGGTCACGGCTGTGCGAGACGCCGTGTGGTGCGCCGGGTAC
TTGGCTCTGGGTCCCGTGTTCACGCGCGAGATGCACACGCTGAGCCCCGCCACCTTCGGACACGTGGACACCGCCACCAAGTCGCAGAAGGCCTCGGCCT
CGATCGCCGGCTGCGTCACCGCCGGACTGATCACCGTGGTGGCCACGCAGCCCGTGGACACGGTCAAGACGGTCATGCAGGGCGAGGCCATGGCACTACC
TGCGGGTCGCGCACCCAGCTCTCTCGCCACCGCCGCTCGCATCTACCGCGAAGGAGGCTTGGCGCGGTTCTACAGCGGCATCGTGCCGAGAGGATGTCGC
TTGGTCGGTGCCGTGTTTATCCTGGGCCAGGCGCGCATCCGGCTCGAAGAGGTCTTCGAGGAGCACGAGCTGCTCAAGTTCTAAAAGCACGTAGGCGCAC
CATAAAGCGCTCGGGTAGATGATAATCCAACGAGCACAACACGATTCCAACCAGCGGCGCCAGTTCTCCATTGATGTGGTGTCAGTAGTCGAACAGCAAG
TGACGTGGTTATCTTGATGCAGCGATTGGACAAGTGCACAAACAGCTGCAGGAACTTCACTTTGAGGTCACTTGCAGATTCGCGGCCAAGATGACGGAGC
GGGCGCAGAGACTCACGGCACTGCAGAACGGGGCCGTGGGGTCCCTCGCCGGGATGATCGAGATGACGATCCAGCAGCCGTGGGTGGGCGTCAAGAACGC
TGTGCAGCAAGGTCGCGCCGTGCCCCGATCGGTTCCGGCGCTCTACCGGGGCCTGGGGGTGTCCCTGTCGTCCATTGCGCCCGTGAGCGCCATCCGCTTC
GCCATCAACGGGCGACTGCTGCGCGTCCTGAGCGGGACCGACTCGGCACCGACGGACCAGGTCAAGGTACTGTGTAGCACAGTCTCCGGCGCAACGGCCG
CGGTGATCACGGGCCCGGCGGAGCTCGTCATGACACTGCAGCAGAACAACGGGAGGAGCTTCGGCGCGACCGTGAAAGCGGTGGTGGAGACCCACGGAGC
CTCGAGACTCGTGCGGGGCTACCCGGCCACAGCTCTACGCGACGCCGTCTGGTGCGCCGGCTACTTGGCTCTGGGGCCGCTGTTCACGCGCGAGGTGCAC
GGCCTGAGACCTCAGACGTTCGGCCACTATGACACAGCTACGACGTCGCAGAAAGCTTCGGCCTCCATCGCAGGATGTTTGGCTGCTGGACTCGTGGTGG
TGCCTCTCACGCAGCCAGTGGATACGATTAAGACAGTGATGCAGGGAGAGGCCATGAAACTGCCATCGGGTCGAGGACCTGGTGTGCTCGCCACGGCCAA
GCGCATTTACAGGGAAGGAGGAGCTCGGCGATTCTACCGCGGCATTGTGGCGCGTGGAAGTCGCCTCGTTGGGGCCGTGTTCATTCTCGGACAAGCTCGC
ATGCGGCTCGAGGAGCTCTTCGAAGACCACGATCTGCTGAGGTTCGACGTTGGCGCCAACTATGAGCCGTGAGTGACGGAATGAAAGAGAACACGCACCA
AGGAGTCAGTCGTATCCTATGGCAACTCGCTTCTTGCTGCGTGCCAGAAAGCATTTCGCAACAACAGTGGTTTGCTATTGAGTGTCATGTGCCTAGTCTG
TTTTCGTGTTTCTTGCGGCTTACGAGAGCGTGCAATGGCATCCTGCCACGCGAATCATTTGTTGCCCTGATTCCTCTGCTGGCGGTGTGGCCTGGTGCGG
AAGTGTGACGCGAATTTTGCCGGTGATC