Description :
From Genome Similarity Track
Location :
contig_73:54486- 55990
Transcript NameFunction/comments
g11705.t1XP_009531418.1 hypothetical protein PHYSODRAFT_316902 [Phytophthora sojae
g11706.t1hypothetical protein

Sequence
1504 bases(100 bases per row)
AGTTGGACGCAGCTCGGGCGTCGCTAGGAGGCTCGGACTGAGGTTCCGATACCACGTTCGATTCCTGAGAAATTGGTGGATGTGGCACAGTCGTCGGCGA
CTTGCCTCCGAAGCTGCTCCGCGACAGGCCGCTGGCCATGCTGCGGCTGCTGTTGGTGTGGAGCAGGTAGTTTTGCAGCAGGCGCTGGTAATATTCATCA
TCGAGCGCTGGGGCCGGTTCTTTGGGTATTTTCGCCAGGGCTGACTGCCTCGGCAACCAGAAGCTGCTCTGGGCTTGAAAAACTCTCGATGCCCGGCGTT
CCATCGCCGCTTGGCCCTGTCGCGCCGCCGTGGGCACAGCAACCCGTTGGTGAAAGCTCTGGTTGTGGGTCAGCAAGCTGTTCCCGGAAGGGTAGCGGCC
AAGTCGAAAGGAGCCTATTTGGTTAGTTGAGGATCCAAACTGGTGGTGGGTCGAGGACGACGCCAAGTCTGCGGATGTGAACGATCGAAGAGATGTTCCT
GCATTGGACGAGGACATTCCAGAGTTGACGGAAGTGCCTCCACGACGAATCTGGTAGTGCTCCAATACTTCCAACAGGGCACTCGAGTCCACTTCATATT
CGTCACTCCCGTCAGTCTCTTGACCTGTAACTTCAGGTTGGACGAATGCCCGCTTCTTCGGGCGAGCATTCAAGCTCAGTCGGTGCTGCTGATACTTCTT
TGACTCGCGCGACGAGAGCACGGAGATGGAGGACATCTCTGCAGCAGCGAGCAGCCGTTCAGCACGCTCCGAAGCCGCAATCGTCGGAATTTGCTGCTGA
CCAACGGACCCGTCGGTGATCGAAGATGCGGTCATCGTCGGGCGGAGGAACGTTGGCGCGCGCTTACGCTTCTTGGCCAACCGCTTGATCAGTCGAGCGT
TAATGGTCGCTCCGGACGGAATCACGGCGCACACACAAGCGAGGCAAAACGTTTCCGTGCATGGTCCAGACGTTAAGCCAGCAGCGGTACCTCCATTGGC
GTGATAATGAGCGCAGAAGATCGGCTTAGTCACGCGGCACGTGCGGCAACACGGCTTCCAGCAACCACGACAACTGCGAGGAGCGTCCCAGAAGAAAAGC
GCTCGAGCGCACACCCCACAGCGCTGTCTGGAGCTGGACTGCTCTGCGATGGCTTGCTTTTGGCCAACCAGCAGCAGTGACAGGTTCTTGGCTTGGCCAC
TCTGTACAGTATTGGCCATGGACGTGAGCCATTCAGCGATGCAATTGTCGCCCAGCAGCGGCGGCAAGCGACCGCTTGGGTTAAAGAGACCGTGCGCGAA
CATGGCCACTCGGTCGTCACCCACGCTCTTAAACACGATCGCCAGCGAGATAAACCCGCGCACGAAGGTCCCAGAACCGAAACCCGCAGAGCTGGCGCTG
CGAGTGCGTCCTGGGTGGGCTGGCGCGGCTGGAGGCCACGTTGCTCCTGTCTGCGCGTACGTGTCGAACGTCGAAACTTGCGCCGAGATCTCATCAGCCA
GCGG