Description :
From Genome Similarity Track
Location :
contig_73:54485- 55989
Transcript NameFunction/comments
g12251.t1hypothetical protein
g12252.t1hypothetical protein

Sequence
1504 bases(100 bases per row)
CAGTTGGACGCAGCTCGGGCGTCGCTAGGAGGCTCGGACTGAGGTTCCGATACCACGTTCGATTCCTGAGAAATTGGTGGATGTGGCACAGTCGTCGGCG
ACTTGCCTCCGAAGCTGCTCCGCGACAGGCCGCTGGCCATGCTGCGGCTGCTGTTGGTGTGGAGCAGGTAGTTTTGCAGCAGGCGCTGGTAATATTCATC
ATCGAGCGCTGGGGCCGGTTCTTTGGGTATTTTCGCCAGGGCTGACTGCCTCGGCAACCAGAAGCTGCTCTGGGCTTGAAAAACTCTCGATGCCCGGCGT
TCCATCGCCGCTTGGCCCTGTCGCGCCGCCGTGGGCACAGCAACCCGTTGGTGAAAGCTCTGGTTGTGGGTCAGCAAGCTGTTCCCGGAAGGGTAGCGGC
CAAGTCGAAAGGAGCCTATTTGGTTAGTTGAGGATCCAAACTGGTGGTGGGTCGAGGACGACGCCAAGTCTGCGGATGTGAACGATCGAAGAGATGTTCC
TGCATTGGACGAGGACATTCCAGAGTTGACGGAAGTGCCTCCACGACGAATCTGGTAGTGCTCCAATACTTCCAACAGGGCACTCGAGTCCACTTCATAT
TCGTCACTCCCGTCAGTCTCTTGACCTGTAACTTCAGGTTGGACGAATGCCCGCTTCTTCGGGCGAGCATTCAAGCTCAGTCGGTGCTGCTGATACTTCT
CTGACTCGCGCGACGAGAGCACGGAGATGGAGGACATCTCTGCAGCAGCGAGCAGCCGTTCAGCACGCTCCGAAGCCGCAATCGTCGGAATTTGCTGCTG
ACCAACGGACCCGTCGGTGATCGAAGATGCGGTCATCGTCGGGCGGAGGAACGTTGGCGCGCGCTTACGCTTCTTGGCCAACCGCTTGATCAGTCGAGCG
TTAATGGTCGCTCCGGACGGAATCACGGCGCACACACAAGCGAGGCAAAACGTTTCCGTGCATGGTCCAGACGTTAAGCCAGCAGCGGTACCTCCATTGG
CGTGATAATGAGCGCAGAAGATCGGCTTAGTCACGCGGCACGTGCGGCAACACGGCTTCCAGCAACCACGACAACTGCGAGGAGCGTCCCAGAAGAAAAG
CGCTCGAGCGCACACCCCACAGCGCTGTCTGGAGCTGGACTGCTCTGCGATGGCTTGCTTTTGGCCAACCAGCAGCAGTGACAGGTTCTTGGCTTGGCCA
CTCTGTACAGTATTGGCCATGGACGTGAGCCATTCAGCGATGCAATTGTCGCCCAGCAGCGGCGGCAAGCGACCGCTTGGGTTAAAGAGACCGTGCGCGA
ACATGGCCACTCGGTCGTCACCCACGCTCTTAAACACGATCGCCAGCGAGATAAACCCGCGCACGAAGGTCCCAGAACCGAAACCCGCAGAGCTGGCGCT
GCGAGTGCGTCCTGGGTGGGCTGGCGCGGCTGGAGGCCACGTTGCTCCTGTCTGCGCGTACGTGTCGAACGTCGAAACTTGCGCCGAGATCTCATCAGCC
AGCG