Description :
From Genome Similarity Track
Location :
Scaffold_8:544838- 546824
Transcript NameFunction/comments
Physo_338975protein kinase, putative

Sequence
1986 bases(100 bases per row)
CTGGCATGGCGCGTTTGCGGGGGCCTGACACGTAAAATCCTGCGAGAACTTGAGGCTCGTCGGGGGCCCCATGCACATGTAGGCGTCATAAATGGCGACA
ACAGCGAAGTCAGGCTTAGTCCCTCCAAAGAAAGCTGCCACCTCGTCGATGCAGAAACCAACTCGACTCGCACCCATGGCTGCTTGACGAACCGTAGTCG
TCATCGCCACATTCGAGCAAGTTGCATCACTATACGTTGTGATTGTTGCTGAATGCCCCAGTGTAAGCCTGTGGCTCTCCGTGCCCGCAGCGTTCGGGTA
GCAGTTTTCGTCCAGTCGATACAGCTTGGCGCTTGCGATCGAGTCAAACACGCCGCATCGTCCTGGGATGTATGTCTCCACTCCCAGGTACGAGTACCCG
TTGAATGCGTTGGAGGCGATGTTGTAGTCGTCCCAGCCCCCACGGTTGTAGTTGGTGCAGTCCGAGACAGAATTTCCAGCGACGCCCTTCACGCAAACTG
GGTCGTTGTGGTACATTTGCGGGGTGCATGTAAGCGCGCTAGTAAATGACACGAACACGGCAGGCGGGGAGCAGGAACTGTTGGTATACTCGACGACGGA
GGTCTTCAGGCCTGCAACGAGCGATGCAGCGAGCCATACCTCCGCTATAACGGCAAACAGGGCAACCATTCTGCGCGGACACTGAATCGCGCTGTCTCGA
AGTGAAGACGAAACGTGGAAGTATGCGGCACCTGGAGACTTTGCAAATGACGCAATATTGCTGCCCTCCACTAGCACGAGGAGCCGACTCGTGATTTTCT
TTCCGAAGATCCCATTCGAGTGGTTTCACCACGACCGCTCATAAGATTTTTCCGCCGTCGAGCTGGAAACAATTTTCGTCTCGATGTCGATGCATTTGTG
AAGCCGATTTTACCCTTTGAACTCGACCAAACTTTGTGCCGTGCATGGCAGCAACACGAGATCATCGCAGTAGCAGTAATACCTCTCAAGTCCAGACTCA
CATTAGAAGAATTTATGCGAGGCCTTGGACTAAAACAACTTGGAGCTTGTACAGCGCCTCGGCAGCAGTTGGCCGTTGGCTCGGGTCTACCGACACGCAT
GTGATCGAGAACGAGTTCTCCTCCGAAAAGTCCACACGGATTGAGCCCATCGTTATTCCCTGGAGCAGCGTTGCGGCTGGAAGTGTATGTCCCTCCACGC
TCGTTCTCCTGAGTATCGCGTACGGGACTGTGTGCATGTCCAACTCGGACAAAATCACGCCAAACGAGAAAATGCCCACCTTGGCTCGCCGAGCATAACT
TCCGGTGCCATCCACAGTGACATTCCAATGCCTGCAGTCATGGTTTCGTCGTGGCGCTGCGAGAAACCCCGAAGTTGGTCAACATGGCGTTCATGGACCG
ACTGAGCAGGATGTTGCGCGGCTTTACGTCCCGATGGATAATTGGAGGTGCGAGCGAGTGCAGATAAGTGAGCGCATAGCACACTTGCAGTGCGATAGTG
GCTTTCTGCTTGTTGAATTCGACTGGATGGCCGGACATCTCGTGCTTGTATATAAGACTGCGTAAGTCACCGCCGTCCATGAACTCGGACACAATGCAGA
GGTTGGAGAGCGAGTCCCACGTGACTCCCAGAAACTTGACAATGTGGGGATGGTCGAGTGTAGCGGATATTTTGGCTTTGGCGAGGAAGTCGTTCACGTG
TTGGAGACTGGTGCGAGTACCAGGCAGCAGCATTTTCACGACGACTTTCTTGTGGTAGAGCTTCCCGACGTAAACATCGCCGAAGGCACCTCGACTGACG
AGCTCCTTGGTTTTGATTTGGTTGCGTGGGATTCTCTTGGCGATGATGACTTCGTCGTCCCAGAGATCGGAGTGATTATCAGCGAGTGCGTCGAGTGAAT
TCGCGTAGTCAGATCCTTGGTCCGTTTCCTCCTACTGGATTTGGTTTTTAGAATTGACGGTCAAGCACGAGTGAGCCTCGATGTCG