Description :
From Genome Similarity Track
Location :
contig_31:5448- 8810
Transcript NameFunction/comments
g7093.t1hypothetical protein

Sequence
3362 bases(100 bases per row)
GCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGT
ATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCCGCGCTCCAACAGAAGGTTGC
AGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCAT
GATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGG
TGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGG
TCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGC
CTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCACTTGCTTTATGCCTG
CCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAA
TTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTG
CGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGAT
GGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCA
AGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAAC
CCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGATCTCCCGCGACAGATCTTTTTTCGACTTTGTG
CGGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGA
ATGGTACAGCTGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCC
AAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCG
GTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATT
TTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTG
CCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGA
CACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGG
TGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGC
TATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCT
CGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGA
GGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAA
CAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGA
GGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGA
AAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGACGAAAACGAGACTTCTGACGAGTCACAGGT
GGAGACGGGGGCAACATCTGATCCCACTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTT
GACCAAGAAACTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGCCAGACCGAAGTGGGTAT
AGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGAAGTGACCGAGGATACGA
GACTGGACTTCGACGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCC
GCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTCAAAGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAGCCTGCCTCAAATTTATCATGTGGC
GGGCTACTTTATGATTATCTGCGGACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTGCTGACGAGAACTAATCTGGAGAGCTACCGAGAGTTGA
ACTGTCTACGGGGGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTG