Description :
From Genome Similarity Track
Location :
Scaffold_1669:5448- 6621
Sequence
1173 bases(100 bases per row)
CAGAGTAGACCAAGCGGAACTTCTGGAGCACTTGCTTCAACGCCTTCATTTGCTGTTTGCTCGAGAGACCGACCCAGTACGGCAGCGACTTGAGATCGGC
ATGCGGCATCGTCAACCCCGTGTGGTTGTGGTTGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAGCTCAGC
TGGGAGTGTATCAAATGGAGCGAATACACGTGTGATTCGCGTGGTGATGTCACTTGTGTGAGCCGACTCCCTTCGAGCCACAATAGCTTCCAGCACTTTT
GTGTAGGTGTCTGGCATCTGGAAGCCGCGGCCGCTCTTTATGATCAAGTCTTCGATCCGGAGCCTTGCCGATTTCACAGATGCGGGGGACTTGCAGCTTG
TGAAGACAACGTTAGGACTGTCTGTGTCTACGGCCGCGTGGCCCTCGGACACAAACGCGTTATCGTTGTCGACGGCCCAGTTCTCCTTCACGACCTTGTT
TCGCATCTCGTCGACCGTAGCATTTACTGCGTTCAACTTGGCCATGAGAGCTCGCTTCAATAGTTGCTCGGTCGCTTCATTTTCCGCGAGTAAATCCTCT
TTCGTCGCAATGAAAATGAACTCGGCGTCCGGTTGGCGAGCTAAAATGACGCGGACCCAGCGCATCACCGTGCGCTCGATGAATTCGTCCATTAGCTGGG
TCTCGTGCTTCCGCACAAGCGCCATCATCGAAGCTTGTAGGAAGGCAACCGTGAAAGCCTCCAGGTCCACGCACACGAGAAACATAGTACGCGGAGAAAA
GAACAGCGAGTGGGCCACCTGGTACGCGTCCTGTCCGGCAAAATCCCAAAACGTCACTTCATGGGCCTTGGTTTCGCGCTGAGGACAGGGCTGCAGAAAG
CGAAGGGGGAAGTGGTCGATGCCGATCGTGCGGTTTCGTCGAGGTGGACAAGCTGGGGTTCTTCGGACGTAATGGACTTGAGTAGACTGGTCTNNNNNNN
NNNGCCGACGAGGCAAATCTTGCGACGGAATACGATCTCACGAGAGGTCTTGAAGTTGTCAATGTATGCTTGT