Description :
From Genome Similarity Track
Location :
contig_121:5447- 8350
Transcript NameFunction/comments
g13948.t1hypothetical protein

Sequence
2903 bases(100 bases per row)
CCCTGCCGGTGTTGTCGGCGTTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTC
CATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGTTGTTCGTTGTCGATTGAAGTGTCTACGCCC
GTCGTAGACATCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTTACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACC
GGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCG
AGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAACAC
GCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGC
GCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCA
CCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAAC
AAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCG
CAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATG
TCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAG
CAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAAC
TGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACGTCGTCCAACAAGGACGACGAGGGTGTAGTCGGCCTCTTGCACCGCATAATCTGGTCGACGC
GAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATA
TGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATA
CTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGA
TCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAG
TCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCC
CGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTG
ACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGA
GCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTC
GTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACG
AGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAG
TACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGC
ATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTT
TCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTC
CTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCG
TCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCG
AGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGG
AGG