Description :
From Genome Similarity Track
Location :
Scaffold_2:54465- 55489
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2-fgenesh-gene-0.15Cysteinyl-tRNA synthetase
Pytul_var.sporangiiferumsnap_masked-pug3_contig_2-abinit-gene-0.95Conserved gene of unknown function

Sequence
1024 bases(100 bases per row)
CACGCTTCTCGTCACTGGTGCGTGTCGTCACAGAGGAAATGGATAGTGACGTGGACGCCCTCCTGACGGTCTACTTGCGCGCATCTATACAGGTCCATAC
AAGGTGAACGGCGTGCCACTGCGCCGCGTGAATCAGGCGTACGTGATCGCGACGTCCACGAAGGTCGAGCTCTCGGACGTCACGCTCCCGGACATCGACG
ACTCGTACTTTGTGAAGGAGAAACCGTCCAAGAAGGACAGCAAGGAGGACCAGTTCTTTGCGCAATCCGGCACCGCCAGTGTAAGTTTGTGTTTGCTTCA
TAGTGCCTCTGGTCCTATTTTTCGATGCTCCTTCAGTCGTGGATCTCCATTCTTTGTGGAGTATCCTATTTAGCTGTACCTATCAGCGCTTGGGATCGCT
GTGTATAAAGTTCCCAAGCCATACTCATGCACGGACATGGGCGTGGGTCCTTTCTCGTCTCTGTATGCGATTAACAGGCCCCAGCGATCAGCGACAAGCG
GAAACAGGACCAGAAGGCGATCGATGCGATCCTGATGAAGAAGCTCAAGGAGGAGCCATACCTGCAAGCGTACCTGAACGCCAAGTTCACGCTCACGAAG
AACGACCGCGTCCACGAGCTCCAGTTTTAAGCTATTGAGCTCCAGGTTGTATAGGAAGAGGTTGTGCTGTTGTTTTTTTTATCGTCGCGTAAACCCGATA
GGTCCATGTTTATGCGTCTGGTGATAGCCCTTGCTCGGCATAAAATAATCATCATTCCTTTCTTGCACTCAAGCGCCCGCGTCAGCTGTTGCGTTTGCGC
CGACTTTGGAGATACTGTGTGTGTGAGAGCATTGTTGTGGTAAAGTTCACACACAAAATCAGTTTGCTTAGAGGATCGGCATAAGAGCATAGAAGGCACA
AACAAAACGCACCTTTCTCCGCTCTCGGAGTGCCTGTCGCGCCCACTCGAGCTCCAGAAGGATCTCTTCCTTGCTGTGCGTGGCGAGAATGGTTGCAACG
GTGAGACCACGTGCGCTGTCAGCT