Description :
From Genome Similarity Track
Location :
contig_121:54434- 58964
Transcript NameFunction/comments
g11398.t1hypothetical protein PHYSODRAFT_321310
g11399.t1hypothetical protein

Sequence
4530 bases(100 bases per row)
CCGCAGCGTATCGCCCTCCTTAGCATACGCGTCCAAGTCAGTGGAACTGCAACCAAAAATGTTAGTCTCGTCACCTTTCTCGTGCAGTATCCAAGCAAAC
TCGTACCGGTAGAACAGCGGGTTGCGGGCATCCACGATCTGCACCATGATATCGCTTCGTTCCCGAACGTGCCACAGCTGACGCCACACCTCCAGGTTCT
TCTCGAACGGGGTCACCTCTAGGTGCTCAGACGACGCCTCCAGCCTACGCCACGACAGCAAAAAATGAGTCAACTGGACTCTTCACGCGTATGCAGCACC
CCTACTCACAAGGCAATATCACGACGCCACGTCAGGAAGCTCTCCTTCTCCAGTCGGTTGAGCTCGTCGGCCGTCGTGGACGCGTCCCAATTCGGGCGAC
GCGGCACCTTCATCTCCGCGAACGTCATCTCCGGAGCCACGTTCTTCTCCTTCCTGCAGTCGGCAAATTAGTGAGCTACCCCACCACTCAATTGCAGCAC
CTCTGTCTAGCTGCACGCACTCAATCAGCTGCGGACCGGCGTCCGCCTCCTCCAGGAGCATGATACTCTCCTTCACGGCGGTGAACTCGCGGTTGGCCAG
CACGGCGCTGGCCAGGAAATCATCCTGCAATTACAGTAGCAATAGTAGAATAGTGAGACCATTGGCCACCAAGTTTCTCGCTACGTGTTGCATACCAGGG
ACGAGCCTTCCAGGTACGAGGCCAACGCCACGGACGCGTCGCCGCCATCGCGCTCGGACACGTGCTTGCCGGCACTGGACGCCACGTCCTTCGTGTTGAT
GGCCGACGTCTTCTTCTGCGTGCGCAGCAGGGCGTTGCCCAGCCCGCCCTTCTTGACCTTCTGCCCCGTGGCGACCCATTGCTATAGCTTGTTCTTCTGA
CGCTAATCAATGGACCGGAAAAGTGGTGTGGTGTACATAATCCAATGTAGCCATGTCTCACTTCAACATGGACGTCCTGTTGCTCTCGTTGCCTTTGACG
ACCGACAGGACGACGCATGTGCAGAGCACCACCCACTTGAAGCGATTTATCTGCATTGAGCCATTGGCACTAGCAAGCAGCGTTTGCAATCTGTCGCAAG
AATAGTGGTTGTTGATTGAAGAGTCGCTGAGTTTCTCGGTGGTGAACTGCCGCCGGCGGACTATGGAGGATGGAGAGCACTCGGATGTGACGCTCACACT
ACGAGGAGAAAGGATCCCGCTCCGGAATGCTGTTTCGTCCGTGTACAACCGCTCTCACCAGGAGCTGCTGGTCGCTACCCCGACGGCCCTCTACTTGTAC
GGTAAGATGCTCACTGCGGGCGGCGACCTGCTTGCGACGCTAGCGGCGGAGGAGAACGTGTACTACCAGTTCGCTATTCATCTTCCTTGGGTACGTGACT
TGCTGCGGATGTATGGAGGAAATTTGCTTAGGTTGGTTGGTGTTGCTCTCTGAAGCTGGATGCCTACTCGGTCATTGTCACGAATGCAAGCGGGGGGATT
GAGCACCGAATTGTCAGGTGAGGCAAGAAGGCCTTACTACTGTAGCTTGTATTACTAACACGCTGGCTGGCGTGGTGCAGCTCAGACCTCAAGACGTCGC
TGACGTCGCACACGCTCCTGGAGAAGGCGGTCAGTTTTACACGGCGCTGGCGAATCCCCATCGACGAGAGCTTATCACTGCAGACACAGACGGAGGAATA
AAAGTGTGGGCGCTGCGCGTGATTGCCACTACACAAAACAACGGAGGGTTCAAGGGGGTTCTGCGTGTACACACAGCTGCGAATTCGGTGCGTCAAATGC
CACTTTTTAGTATTCCCTTCACGCCATTAACATTAGTTTCGTTTCGGTTCGACTCCGAGCAGACGAAGAAGCCGTACTATCGCCACCTACGCATGAGCTT
TGATGGACAACGAGTTTTTGCTGCAACCAGCTCAAAAGTTTGTGTGTTTGATGCGGCGTCGTGCAGTCGTTTGTCATGTTGCCTGAGCGAGGATCGACGC
GCCATATTCAGTATGGAGTGTGGCACCGAAGATAACAGCGTGCATCTCGTGTTCAGGCTCAACATGAGGTAATACTACGCATATACCCACGTACATGTGA
GGTACAGACTGAAGCTTGACTATGAACCAGGAAAATCTGCAAATACTCATTCGTCGTGAAGAAAGGAGTGCCGCAGTTTCGAAGAGTGGGTGAGTACGAG
CATGACCAAGACCTCGCTGTGTTCATTGAAAACTCTCGGCGTCATTGGATTCTGAGAACGGGGTCGTGATGGTCGATATCTGTGCGAGGTTTATGACCAC
TAACCTAATCGATTCAAGGCAAGTTGGCGCTGGCAGTTCGGGACACGGTCGGTCCGCCGTAACTTTACCGTTCAACCCACCGTCAGAGCGATACAATGCA
CTTCATGCAGACATCGTACCTGACGGCCGGAACTTTGCCTTCGCTGTGTGGTCGACCGGCTTTTGCATCATGGAAATGGTTTTCGCGGACGACCAAGGAC
GCCTTGTCTGCGATTCGTTCAGCGGCGAACGTCTTAAAAGACTCAACGGTGTAGAAGAAAGCGGCACCATTTCTATTTACCAGCGACTGCCTTCGGCGCA
AGTGGCGATGTTCAAGGAGGGAGATCCCCATTTTCGTTTCGCGTCACTGCCAACTGTGGTGGATTCAAACAGTACAGAGGAAGGAACCACCCTTCCCATT
ATTGACTATGTCGTGGCAGCAGATGCCATCGTGGCGTTATGGCCTCACGGGTTGGTGGAGAAGCATAATTTGTCGGACAATCGGTTTTTCAGGATTGCAC
AACCTTTTGAATCTACAGCGACAACTGCATGCACGGTGGTAAGCCTGTACTTTGACTATCAGGCGTGTGTTGCTGTCGGTGACTCAGGCGGGACTATATG
CATTTTCCCTTTGGGAAACAACGACACAGAAGCGCACAGTCTGATCACCCGGAAGCAAGCATATACGAACGACAGGTGAGCATTTTATTGATTTGGCTTT
TTTCTTAATCACGATACTTTACTGACCTGTTGTTGCCTTGTATCTTGGCCACCAGTGTGACCGTATTGATTGATCTTGCCACCACGGAAGTTGGTTCCTC
GCTTCTTTCTGTTAGTCGAAATGGAGAAGTCAAGCATTGGCTTATAAAGAGACCGACCACTCCTGATCAAAGTATTGTCTGGGAACTACTAGCGTGCTTC
CGAACCTACTCGCCTGATGTTTCAGTAGCAACGTTTGAATCTCCCGAGTTCTTGTTTTGTGGGTTCGACGGCGGAAGCGTCGAGTGCTGGAGGTTCCCGT
TTGGTCCGGACAAATCCTCATCAAACGGCTCACGACTTCAGCAACAAGCTACACATCGCATTTCAGTTGTAAAGCGGGCCTTACACATCATCGATTTGCA
CTTGGCGCCAGTACTCAGCATTCTAAGCGAGTCAGGAGCTGGAGTGGCAGTCACTGCCAGCCCACAACCCGTGTCTGACAGCTTCTCGTGGGTCTTTTCG
TACGACGAAGATGCGATTATTCTCGTTTGGTGCTTTTCTCTCGACTTCTTCTTTCCACACCGGCGGATTAAGGTCCATGAGCTCATCAAAGGTATCTACA
TCTCGCCATCCAACGGGTAGGTCCTGTGGTATAATGCGTGCATGTGAGTACTCGTAGCGACTAATTTGTGTTTATTTTGCTTAGTTTCTTGGACCTCTTC
GCGTACATTGATCGCTGTATCGATCGGGTTGATCACCTCGGGTCCGGTGACAAGGAGGCTGTGAGACTCCGTCTTCGACGAGGACGAGAACTCTCTGCTC
AACGTGACTTGAAGAGCCTTGAGAGCGGCAGTAACCAAGCCACACTGACAACGGGACGTCGTCGCGGCAGTACTCGGACAGGCCAGAGATCAAGTTTATC
CACACCGGAGTCTTATAATCGAAGCCGATTCATGACGGCTAGTGTTCCGTCTGTTCGGATCAACATCACACTACCCGCAGTCGAGCAGAAAGTGAATGCA
GTGCGCAAGGCATATGCCGAAGCTTCTCCAGCGAAACCTGTTGCTGAAGAGCCCAAACAAATCCAGACTCCTTCTACCGACAAGCACCTCGATGGAAAAG
ACTCACCCGGTGAAGTAAGTATTTTGCAAAACGTTCTGAGCTCGTCTCCGACTCGAATACTGGAACGGCCACCGCCAAAACCCAGAGCACGATCTCCAAT
GTCGCGCCGAAGTTCCTCACGCCACTCATCCCAATCACCTCGACGTAACAAACGCAGCAAAACGAAACCCCATACACGCAGCACTGTGCGCGACGCTAAA
GCCAACTATCTGCCAGGAGAGAATTCGCTTCCGAGCAGTTTTCAGCAAGCCAAGCCTCGCATCTATCGGAAGGCTGTCAATCCGTTGGATTCACTTGCAT
CACAAGCTCGCTGCGCTGTTATTACTGCTGGAAATGCATCACCATCGTCGTCGCCCTCCTCCTCTGATGATGAGGACGACTCTGAACTCCCCGATACAGT
TGATATCCCGAGGAGTCGTGCGAGTCCAAC