Description :
From Genome Similarity Track
Location :
Scaffold_54:54431- 57257
Sequence
2826 bases(100 bases per row)
TGATTTAGGACCTTGTCAAAATCTGATAAAAATTACATGGGCCATACTTGTCGTCATGCATTTATCAGATTACTATGGACGTTGACAGCAAAAGATTTTG
ACTAGAATAAATGGCGGATTCAGCCTTTGCTATGAGGGTCTGACACCAAACCAGTCTGATGATTCTGTCGATTACGGTACTGCGTTGATAGGAGATCGTG
AGAGGTATGCTAACGCTGACAGGTATCAGCAGAGTATGATATACGATCATGCTATAGCTGCTCTAAATTCTGCAATCGTTATACTGGGTTGGCTAGGATG
CGAGGGCACCCAACAGGCTCTACTCGCCGCAATTTACCACATATTGAGCATACAGAAAATGAATTTGATTCTGCGCAACGTCGACTGTGTGAATGCCGCG
GACAACAAGAGCACAACGAAAGACCTGTCGTCAAGTTAAGCAGCGCCTGGAGTACCTCCAGCAATGTGACGTAACAACGATATCACGCTGTCCATATTGT
ACTTGATGCTGTCGATACTGATTTAAACATCAACATGTTGATGTAGATGTTGATAATCGTTGACAATTTCCAGGTTACTTTTACTTAAATGCCATCACTA
GGAAGTTAAACTCCCACCAACCGCACATAAAGTCGTGTTCGAATGGCTCTCCTACAATTCCCCGAAGCTGTCCACCACAGGCGGTTCAAAAAGATGGGTG
TATTATAGCGCTCAAGAAAAATTATAGAATGGGCAGCATAAAAGATGAAGTTTTCATTGACCATCGATAGACCTTCAAAACCAATTACTCGCATTATGTA
TGGATTGAAGGATCATACGCGAAAACTGAAACCACATTATCCTCTCCCTAAAATGTACAATGATGGGCGTCACATCTTTAAAGAATGTACTACATCGCTA
CTGATAGCTCAAATTCAACTTTTACGTAGCGGCGTCTTCTAGTGATCAAAAGGTATATGATATAGCTACAGCTAACTCAGTAAACTATTGACTAATCGGG
GGCCGATGCCTCTACTCGCCAGACTTCGGTTCCTGGAGGATGGGGCAAAGTAAAGGGATCGCCCGGCTAGAGAAGCCACCCTCCCACCAAGTAGCAGCTG
CACACTTAGATCGCTGAAATGCAAGAAGGACCCACTGTGGAAGGAGATGACGACGCTGACCTGTGACGACCGTCCGTACAGGACATCTAAGGAGGATTTA
GCCCCATTTGCAGCAGATTTATTCGGGTATAGTTGGTGGAAGGACTCAGACGGGATCGATCCTCGTGAGGGAGGGATGTTCGCACACCACTGAACCGACC
AATTAGAGAATTATGCCGTATTTAAAGAAGCGGACTTGCGCATGATCACAGATGCGGTCAATATGTTAATTCCTCGTCCCATCCAAATAGAGAGCGCGGA
AAAACCAAAGTCACAACCACCAGGGCCACCCAGGAAAATATGTTTACTGGCTTAGCCACCAATTGAGGAAGTCAACTGAATTTGGACAGGCTGAGTCTGA
AAGATCTAGTGAGCCGGCGTTATTTGCAAAAGCGTATTCAATTGTACCGTTGAAGCGTGAGGCTATTAGACTGTAGTGTGGTTGTCCTCACATGTGCAGA
AGATGTAGGAAGTAAACGTGAAATATATTGAGTGTTAACTATTCTCTCTAGTCAACCCTATCATATGCATTGCACCAGCATTGCAACTTGACCTGGTAAA
GGTACACTTGGCATACATCCAGCTTGCCCATCACCATGTGCTGGTGCTGGTCCCACATGACGTCCGTATGCAGCTGTTTCACCTGCCATCTGCCTCGATA
GTCCGACATGACGATCGTCTTCTCTCGCCCCATATGTCGACTTGTCTCGTCTTTGTCCCACCTATCAACTTGTCAGCTTATTAGTGAAGTCGCCCTTTAC
TACAGGCCTTGCAATCTATGCCGGAAACACCATTGCGTGTCAAAGACGATATCTTTTAACAGAGGCTCTGCCTAAAACTTGGCAATAATACCTGGCTCTA
ATTAGCCTGAACGAGGCTAGTCTCCCTGAACTTTTTGTTCAGGTGTATGTCACCGGAGACTACACTTTCTTGGAGTGGTAGCAGCTTGCAACTGCTGTAC
CAACAAAAACTATCCTTTAGTGGATTGAATTATTAAGGAGATCGTGCAAAAATTGACATAACGACACTAATGGTATCAGGCAACAGTATTATATAAGTGG
GCGCAAGTATTACTAAAGGAGAGCCCCCCCAGTAAAATGACGTCTGCAATCGACGGTTTGTCATGTTTAGCCACGCCAAATGCACGCAAATGAGATCACC
ATGCTTCTAATCTGTGCGCATCTTCTATTAGTTCAGCTTCTCGGCACCACATTTGCGATTGAACGGATAGAGGTTGATTAATAATCGCGGGTATTGTTGA
AGGAGTGAGTGTGTGCCGGAGGATGTCAGATTTTCTGCGAAAGGACCTTTAAAGTGTGAATATGCTTTGATTGTACAGTACGGTCCAAGCGCAGGTTCAA
GGCGAGATGAAGCTCCACCTTTAGATTGACGCTGAGAATTCAGGTTATTCTTCACTATACAAAATCATTCACTGACTAAATGTGGCTTCTGCTAATGAAG
CAAGGGTGTGTTTACCGGCTCTGAATCAGATGTTGGGAAATAACGACGACATATATATGAATTGGTTTAGACATCGATACATTCCCATGTCTTTACGCTG
GAAACGGCGAAGTATCACCATAGATTCAAGTGCCGTATTAAGGGGTTGTTTATATTGTGCAAAACACATACTGTATGTAGAAGGGATCGATATATTTACG
TAAGCAAAGCTACCGTAATAGAATGG