Description :
From Genome Similarity Track
Location :
Scaffold_97:5443- 8482
Transcript NameFunction/comments
Phyca_LT1534130762PREDICTED: stress-induced-phosphoprotein 1-like

Sequence
3039 bases(100 bases per row)
aaaaggccaagcttgcctctaatggagtcgttgcagtggagcgcatgtcggctgagagctttgcagagatatactatcacctgtacacggacgacatgcc
cgtatttgtgaccgcagactcgattctacatgcgtggcaccgcagctttgacgcttttctagtcgaggcggaggagcaggtgctgtcgccaatactggac
aaagtgctagaaacaacactctcgaagtgcactgaagccatttcttcttctccacggggtgtctatgacaaaagaaaagcgatggtggatgttgagctct
atctccgagtggcattgagccttttgcgagggaagtcagtcggtggtctggctgagaacaaagccaagctgaaacgattgttggctttcatccagaagga
gataacaacagagacagagatattgtcggcaacgcgtgtcgtcgatttctcgcagtttaaacctcgtggacactacacgaaatctgaggagctgaagcga
tatttccgatccatgatgtggctcgggacggtcgatttccgtattgctggaggtggaaatcagcgtaatgaccttcatcagctgctttgtgcagtgttgt
tagtgaattacttacaggaatcaaaaatgatggaggctgtggagggagttgacgcactgatttcgagcttggttgccgatggaggaatgggagctgactc
gctctcacctactcagcttgcatcacctgggcgactggctcaattactattagttgaagctgagtcaacagacccagatcctttgaagagctttcagaag
ctgattctcgaaaaaggaattggagcccaactgatcaatggccacccgcgtactgaggatattgaacatttattgtcttcaacgccgatgcctccactaa
catcatttgctctccttggacagcggttcgtctggagttccttcatcttctcgcgtttggtcttcgaccaggttcgttttgaagataaaaagcaaatacg
acgcatttcgagtgcagttgacgttgcctttaccctgtttggcaacgactgtgctgcccaagttttagctgatcgaatgaatgccgaacctctggtggat
cctggatttggttcgccgaaattcgttccgttccgagatggcatcccgttctcatcgaatcttgtggcactccgtcaactgttagacaaggagttcgacg
acgaaggcgactcaagtctacttgaatcggatggagaagcaagtattagcatgctatggcaaagagctctgcgtgccttgtcacgaccatctccgaaccc
atcgaaaacattccactcgaaggtttggcagttgcgcaagatgaatacgcagttgggatcattcactcagctacggcatgatacgttactttatacgaag
caaagctacttactgaggggtggttgtgagtatgccgacggtatggtggatccgtatcccctcttctggaagcgaatgggagagctttcgagccaaatgg
ctaccgtgattgagaatatgttgacacctttggtcgaattttctgtcgagcattcaacgagttcaagtaatacttattggggtttgcctaagagcaagtg
gttcgaagacagaagcaaagggtttttccattcttttgcgaaaacgatgcagtcgattgaagagattgccagtcttcaggccgaacacaaacccttgagc
gatgatcaagtgaatttcttgaaaacagtcatggaagagcgattcggaagcggcggatcaaaatactgcgggtggtaccctggactattctttaaaagcc
gtcaagactcaggcaagagcgacgtcattgtagctgatatccagacagactcgccatcacccgtgcacatggatccaggtggtattcttcatctgggcgt
cggacaccccttgatggcattcttcgttgtggacaataccatgttcgcaggaccagtgttcagcagctacgagttcgtgacaccgatcgataatcgcctg
acagacgaggaattcgagcgcaaactaccgggtatgcggatgcctgagtgggcgcatcgatcgtatttgtgctaggtaatgtcgaggcgacgttcgtagg
gtgtatttcttttaccggttctgcttattgatagtggtgtcgcgagaagtttagggcaagttgaagaccattatgtaggtatctgcaattgacatcaaac
gcgagtccttgttgaaaagctctactggcttctgcgaaccgtccaagaccacagagagcacaacctttacgatagtatccctaataagattgaaaaatca
gagtaggtttgaaaaaaaaagaataaaaatgacgtactacagtcgactttgggtccaggagtacaacttgttctgcgtcttgtagcgccgctgagtggtt
tcccatagctgctaagagagtcgagcgcctcgtgtacatgatacccaggttctttcgagtttccgtgtttaaacggatgattttgttatacatctccagc
atttcctcagcctcatgtagcgaaagtttcgttgtcgtgtcaagtgccagtgatgctaatgaaaatcccttcttttcaacgttttccgaaatatcaccag
tccggggaagagctgtgttcttggagtatagcgaaggtaacagtgaaatgttggcttcgctagtaaagttgtgctgatgacgaagggaactggtgctttt
acaggctcgtagtagcaccgagtcaagttcttccccggagtttacggtcggatactttggtgaagtcagcagcgtcatggacttggtcaatggcgagttc
tgctcggcaagtaaggcgagtttgtgggaaaactcgatggattcgaggtgcggtcgtgagttccgcagcgttaatttgtgtgcatcacaaacactttcgt
tgtatcggcctctctttgtgtcaacaacgcaggcacactcgagaaaaccaggagtggcaaacgttttggccacagtcgttgagtttggaggatgccgagc
cacgcggctagcacgaaattcgtctaggaggggatcacg