Description :
From Genome Similarity Track
Location :
scaffold_46:54429- 55857
Transcript NameFunction/comments
Plaha_PHALS_09889hypothetical protein

Sequence
1428 bases(100 bases per row)
ATGAGGAACACATGAAGTGGGCGTCTGAAATATCTCTACCGCTTAAGTATATCATAGCAGAAAAATGACAGGGGCAATAGTATATTAAAACATTATTATC
ATCGCAGACCAAGATACCACTACCGGCCCATGTATGGGAGAGATTGTTTGTTGTCTACACGACTGACGACTCTCGGCATCTTCGGTTCTATCTGAACAGA
GTAGGTTTAGTGagtcagcagctgcaaagAAAGCAAACAGGTTTAATAGTCAAAGTAACAAACACCCAGACTATATTCAATGCTAAATTTTTATTAATAT
CGACGCAGAATGGCAAAATTTTGGTAGGATGAGATCGTCGGGTGTACCTGCACTGATCAAGGAAAGTGTATTGATTTCGGTGGCAGAAACCACAGGTTCA
AAAACTATTAACGGCATTACTTGATTTGTGGTGGATCGTTTGCTGAAAAATAGAAACTAACGAGTTGCTGATGTGATATCTAGAAAAGAACAAATACAAC
CATCTCGGTGTAACTCCGACTATAAAACCATAGATGCCAAATCTATTCCGTAACTGTTCTTTAAGTTTGATCAGCTGACGTTCGCAATATTAAGTGGCAA
AGATAATGATGTTAATATTCGATGAAATCAAAGTCGCGTATGATGCGTAAATGCTTCTCAATTTCAATTCAAAATTAGCTTTCAATACTGAGATTCCGAA
GAAACTTTGTAGACATAAGATACCATTCAAGCTGTCCCTTTTTCAGACTAGTTTATCTGTCAGTAAATTATGATTATAGCACATCAAATTTCTATAAATT
GGTGGTACCAGCGATTGTAAAGGGGCGCCAAATCAATTTGCCAGCTATGACAGGCACATTTCCTAATTGGTAGAAAGTGTGGAAGTTTGTTATCCATCAG
GCTCGAATTCCAATTCCGTGTAAACAGCATCATCCAATCACACCACAACTTTTTACAACTCACGCATGCGTCAAACATAGTGAGACAATCTATTGGGAGA
AAACATTGACTTTTAACTGTTTATTTTGGTAGTTTGGCTTGTGCCTTACTTTTGTAAACGCGTTAGGGGAAATGATAACGTAGGAGCGAAATATTGTTCT
GCTATTCCAGCCGTTATATTTAATTATTTGCTTGGGTTGCTTATACCTCCATATGGAGATATAaacaaaaatgtaaactCTGCGCAAAGCAATGAAGCTC
CTTGTCCACCTCGCCATCCTTTACGTATATCAATTATCGTTCTACATGTGTTACTTTTGTATCCGTGGCTGGTATTTAAATAAGCAACCTTTACTTCAAC
TACCACTAATTCTATGCTGCCCATAAATAATTATCTCGAAATTTCCTCTAAAAGTCTACTTCAGCAAACACCCGCCGACGAGATGTCATGGAAGCCACCA
TGCCCAATTTATTAGCGGGTGGAATGAC