Description :
From Genome Similarity Track
Location :
Scaffold_12:544176- 547708
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04779Hypothetical protein
Sappa_CBS223.65SPRG_04780ornithine decarboxylase 1 putative

Sequence
3532 bases(100 bases per row)
AGGATGGACTCTTGGAGGCCGAGTTGGATGCGGTTGGTGTACTGCAGCGTAAAGCGGTGCAGGCCGTGCGCTCGCCACACGTCGACTTCGTCGTTTGTCG
AGAGCCACTCGTGCTGACGCAAGGCGGCGACCCACGCCGCGCCACCCGGCGTGCGGGCAATCGGATCGGCCACGTGCACCGCAAATCGGTTCTGGACCAC
CTCGAGCCAGTCGTGAAATGCAATGTTGCGCAAAACAGCTTCGAGAACGACGGCCGCGTTTTCAAAGTCGTTGCGTTCGCAGCGCAATTGCCGTGCGCTT
GTGTGCGCGAGTTCCCAGCGCCGGTTCAAGTCCACCCAGCAGTACAGCGTGGCCATGGACGCGACCTTGTCCGCATCCAGGTGACGAAGACCCGTGACGG
CATCGACCAAGCCCGTGAGACGCTCGTAGAGCAGCTTGCGCGGGTACGACGGCGCCGCGCACACGGTTTGTGTGTCGACGACCGCGGCCACCGGCATCAT
CAGCGCCACCGATATGGCGGTGGCATTCATCGGCAGGAGCGCCAGCTGCACGTTAAAAATCTCCGAGACCAGTGTCGACACGTTGAGCGTGTGAAAGTTG
GGCCAAAAGTAGTCGCTCGCAAGGTACGGGTCCATGACGAGAACACAGTAGAAGCTAAGGCCCACGGACGAGAGCATATAAAGGATACCAACCACGTCAT
AGTACGCGCAGTGCTGTCGCGGTGCGATCGGTATCAAGTCGGCCGTTGGATGGCGGGCGGGCGCGACGCTCATGCTCGGTGGCGCGGCAGTTGCAGCTTG
GACAACTGGCGCTGTAACCGCGCCGGTTACGTCCTGTCCCGAGCCACATTAAGTCCCTGCGATGTGCGCGCATCCCAGTTCACCGCCTCGTACCCGCGGT
GCCGCATCATCTGCAGATATATGTCTGCGTGTGGTCTCGCTGCAAAGAGACGGCGTTCGTCATCAGTGTCTGTGTTGCGCCACTTCGCAGGTCGTGGAGC
CACGGCTAGGTCTGCCATGTCGTCCGCTTGTCGGCGTCCAGTAGCGTGGCTTCTCAACTGCACTGGATTGAAATATACTACGATACTTCGGGCGAGTGCC
TTTGTGTATTGTATTGTTGGACAGCCACCACTGAGTCGAACGGTGAAACCCACGCTTGAAGGTTTCTACCTGGTTTTCACTGTGGGGCGTTCTGGGAAGG
CGGCTGACACCAATTCTTACGCTGGGATCGTCGCGGGGCTTCTTTTCCCTGGAAATTGGAACGCGTGGCACACTATTGGATCTAGAAGGCTGCGAGAAAC
GAGTGGCCGTCGAGCTCGTTGTCGCGCCCAAGGTGGCTTCAACTCGGGCGTCGGGCGAGTATTTTTCGGATCGGAATTGAATTTAAAAAAAGATGGCGAC
CGTCGCGCACGACAAGATCGTGGGTTTTTGGCTCCTGACTTGATGTTTGTATGCGCCGTCACGTTACGCGCGTGCCTAGAGTCTGCGAGGAATGCTGAAA
TCCCAATTTAATACCGAAAAGAAATAAAGAAAAGCACGCGGAAGCCGCCGCTTTCTTTATCGAGGACCACGATGGCAGGGACGACGCAGAGCAAAGCGAC
GACCCTAAAGTGTGTACACGCCCCACTGCTTACGATAGCTCTTCATTGAACGACGACAAAAATATACTTTGAGCTCTTACTCGGTTCAGGGCTCGGTTCT
CGGTCGACGGAGAAGAGCACAACCGACGACTCGGGGCTAATTTAAATGCCACCCAGGTGAGTCACACCCCTAAGTGACGCCCACCCTGGTGGGGCGTCCC
AATTATAGAATCCTCGGACATCACTGGATGGCATACAAATACCAAGGTCGCTTTAAATACCGGCTTTAAATGATCGGCTACACTTGACATTTGTATGCGT
CGTTTCTGCGTTTTCATTGGTCCCCATTTTTTCGTGGAGGTCAGGGTGGTGGTTTCACGTGACCGGGATCCTCGGAGACTATAATTTGACTTGTAGTTTG
TATACTAGTGGTACAATCACTCTGGTTCGGATTTGCGAGCCAACTCTGCCGCAGCAACCTCACTTGCCATTTGGCTGCCTAACGCTCAAGAAAGCTCTTC
CGTCGCCGTCGCACACCCGCGCCGTCGCCGCAAGACCTTGACTGTTCAGCTCGTTGGACCCGCCCAAGATCCGCCCAGCGTCGCCACCGACAAAGTTCCT
AGGGACCAGCACGTCCCTACGCTTAGTGTTTGATTTCAACGTTGAACCTGAGTGGTTCCCGTGCCGATAGCACCGCTTGACACAATACCATGCTGCGCAC
GTCTCTGCCTTTTGCCCGCCTCCCGGCTTTGGTGACGCGGGCCGCCTTCAAGTTCAAGACCGGCCACCGCGCCGGCCTTGCCACGCACGCCACCGCACGG
TCTGCCCGTGCTGGGGTGGCCGTACACGGCAGTATGAAGACTCCACAACAACAACAACAACGTGGCCTCGCCTCGATGGCCCTCGCGGCCGTCGAAGAGC
CCGAGCACATGGTGTGCGCGTCGACGGCGGCGGCCAAGGACGCGATCCTGCACCGCATGTGGGCCCACATCCAGTCGACGGGCGAAGAAAACGCGTTCTA
CGTCGTCGACACGGCGGCGATCGAAGAGCGCTACAACCTCTGGATGCAGCACCTGCCGTTCGTCAAGCCGTACTATGCGGTCAAGTGCAACCCGGACCAG
CGCATTCTCTCGACGCTTGCGCGCCTCGGCACGGGCTTCGACTGCGCAAGCATGGCCGAGGTCAACGACGTGCTCTGCGCCGGTGTCGACGCCAGCAACA
TCATTTACGCCAACCCGTGCAAGCAACCGTCGCACATTTCGTTCGCGGCGACCACCGGCGTCAACGTCATGACGTTTGACGGCTGCGACGAGCTCACCAA
GATGAAGAAGCTCCACCCGGACGCCAAGGTCGTCCTGCGCCTCTTTGTCGACGACTCGCACTCGCAGTGCCCGCTTGGCACGAAGTTTGGCGCTGTTCTC
AACGACGTGCCCGCGATTCTGCGCCACGCCAAGGCCATCGGCTCCAACGTGGTCGGCGTCTCGTTCCACGTCGGCAGTGGCTGCTTCAACGTCTCGGCCT
ACTCGGACGCGGTGCTCCGCGCGCGCAAGGCGTTCGACATTGGGGCGAGCCTTGGCTTCAACTTTGAGCTGCTTGACATCGGCGGTGGCTTTCCCGGCGA
CGAAACGGCGCCGGTCGCCTTTGAAGACATTGGTCGCGAGCTCAACAAGTCGCTGAGCGAGCACTTTCCCGTCTCGTCGGGCGTCCGCATCATCTCGGAG
CCAGGTCGCTTCTTTGCGGCCGCCAGCCACACGCTCGCCGTGAACGTGATTGCGCGCAAGCTCGCACCAAACTCGCTCGCGGCGCTGACGCCGTCGGGGT
CGTCGCCGCTCAAGGCGTCGCAAGGCAAGCGCGGGCTCCACGGCAGCGTCGACCCGTACTACATGTACTTTGTCAACGACGGCCTCTACGGGTCGTTCAA
CTGCCTCTTGTACGACCACGCGGTCGTGCATC