Description :
From Genome Similarity Track
Location :
Scaffold_16:544146- 545538
Transcript NameFunction/comments
Phyin_T30-4PITG_22859Putative uncharacterized protein
Phyin_T30-4PITG_08732Putative uncharacterized protein

Sequence
1392 bases(100 bases per row)
AAGTTTCCCAGGGAAACCCATCCGAGTTAGCGACACCACAAACTTGGACTTGCTAACGAGAGTGATTATTACTGCAAGAGAAGATGGAGCTACATGTAAT
GCGAGAAGCTTAGGCACAGCAAGAGCTTGAAGGCTGAACCGACCAATCCTCGGGACGGTTCGCCTTCAAAATCTAATCCTTCGAATGCTACACTGTCAAC
TTTTGAGCGACTCGAAAAACTCCACGTTGCACTCGCAGAGAATGCCCTACCGGTAAATTTCCATAAGAAAATTGACCTACCACCGATATGAAGGCCCTGG
ATGAACAGATAAAGGAGCAGCGGCTACTACCAGTACGTTTCAAAAAGGCGAATGATGGACGAACGATCGTGTTGCCCTTCCCGTTCGCAACAGAAATTCG
AGCTGCTTTGACAACCAAGCTGAAGAAAAAAAACGCGTGATGATAGACTGACAGACGAAGAAGAGCGAGAAGTATCATGACAGCGACACTTGCAACGAGG
CGCCAATTAAACTTAAACGATGATCCTCATGAGGTGGTCAAACTCTTTACTCACAAACGACATTTCCTGATTCGAAGCTCGGCTTAGGCAGCTTGCAACC
TACTTCGTATTAGACAAAAGTGCCGTGGTTGTCTTCAAGAAAACCTTCCTTTTCTTCGAAAGTATGTTTTTTTCGTGCGTCAATGTACTGCTGTTTGCTG
GTTTTTTGGTGCTGACACGAAGTCCACTGACGAGAATGCTGCGGACAGCTGCAATACTGTGGGTTTTTGCAAAAAAAAATCTTTTGGAGTTCACACACCT
TCCTGCAAATCTGGTCACTTCGTTCATTCCAACGTTGAAATCGGTTGGCATACATATTTTATGGGCTTACGGTACTGAGCTGTGGCAAATTGCCATTGGC
AATGCCACAGCTCAGCACTGGCATGATACATGTACATGTACAGCCACTGCGCAGCTGAGAGGTGGTGAACATATAAGCGACGACAAAGGAATAGTCATGG
GAGATGGCCAGCGTGTTGAGCGACTACAGCGACGATGCGTCGCCCGCTCATCGCCCTCCGTACAGCCAGGTGATCCGCGCGTCGATATTACTCCGCAGAC
GTCGCTCCGCGTACGGAAACCTCATCATTAAGTCGCCTAGAAGAGTTCTCGGAGCTCCAGGTCGAACTTGGTGGGCGTTTTGTTGCTGTCAGGCGAGCAG
ATCGTCAGCCTCCGCGAGGACTTGTCGGCAGTGAGGTCGATGCGCTCCACGACGACGGCATCAAGCGCCACAAGCGGCGCGTCGAGGTCCTCGCGATCGC
TGCGTAGGAGCAGCTCAATGTCCTCGTTCGAGTAGAGCCCGAAGAGGTTAACGCACTTGATGCGGCACTTGAAGCGGTGGTCTGCACAGCAC