Description :
From Genome Similarity Track
Location :
contig_128:54411- 59534
Transcript NameFunction/comments
g11524.t1hypothetical protein
g11525.t1hypothetical protein

Sequence
5123 bases(100 bases per row)
GCGCCGTCGAAGCGCAGCAGCCACTCGCCGCTCATGCCGCTGTCCACGTCCATCGCGGCCACCGGGTAGTCCTGGCGGTCGCCGTCCTGGACACTCGAGT
CGTCCTTCGTCTCCTCGTCGCTCGTCATCTCCGGCGGGAGCACGCGGTGGCCGATCCGGAATGCCACCACGCCGCGTGGCAGTGGGGGTCCCCAGCGGGG
AGCTGGAACCTCGCTGAGGCGGGCTGCAACACGGCCTGCCACCAGCGTCCTGGGTAGGGGCGGGCCCCAGCGCTCGCGGGCTTGTTGCTCGGCGTGGTCC
GGGTCGACGACAAGAGCGGAGCTCGCTAGCGGGGGGTCGCTGCGAGCTTCGGGGGGTCTTGGCGGGGGGAGTCGGGCGTGACAGTGGCCGCCTTGACAGT
GGCGTTGGCTGCACCAGCAGTGGGGCTCAATTCCCCTGCTGCCGGCGCAGCCGCTGCCGAGAAGGTGCGGTTGAGGCTGGCGCACGCGTGTGCGTGGTTT
GCAGCAGCCAGCCTCGACGCGAAGGGCACACCGCACGCACATCCCGCCGAGAACCGGTCGAGGAAGGCAGTGCGGCGGTGCCGGGAGTCCCGGTGTCGCT
TGAGCGACGCGAAGCTGGCGGCCGTGTACGTGCACAGCGTGCACTGGAAGCGCTGCGCATTGTGCGCGTACACGGAGAGGACGGAGGCCGGGCGAGCGCT
GGCCGCGGATAGCCTAGGCGCTGGAGCGTGGTCCCCAGCCTCGTCCTCCTCCTCGAGCAGGAGCTCGGCCAGCTCGCGGGTGTCTTCGTCGTCGACGTCG
TTGAGACGTCGACGCTTGCCGCCGACGCGCTGCCATGGCGGCTGCTGTCGGCGGGCACCTTGGTCAACATCCATGGCGACGACGCCGACGTCGCCTGCTG
CATCGCTGCTGCCTGCGCCGTCGTCGCCGTCGCCGCTCGCGTCCGTCGTCCTGCTGCTGCCGTCGCTGCTGACCACGTCGCCCGACATGGGCTCCACGCG
CGCGCTAGCTGGGGGTGCTTGTTCTTGGGGCGGCTCGGCGCGCGCGGGGCTCCACGGCGGCGCGGCCAACAGGAGAGGTGGCAGGGGCAGCTGCGACTGC
CGTCACCAGTGGGGCGGCAGCAGCCGCAGCTGGGCTCGGCGGCGGAGCGCTTGGGGGCGGCGGGGTGATGCCTGGTCGGCGAGCATGCGCCCGCCCTTGC
GGGTGAGGGCAGCACATTCGCGGGGGATTCGGGGGCCGGCGGCCCGTGCGCACAAGCGGCGGAGTTGCGGGGGGCCGGCGCCGCGGCAGCAGCGGCTGCG
GGCGTCCAGGGTGACCCACCGGCGGGCAGCATGCATGCCGCCCTGCCGGGTGGGCCATCATCGCGTGGGGGTCGTGGCGGCGGCTGGCGGCGGCGGCGCG
GTCGTCCGGCGCGTCCTCTTCGTCGCTGTCGTCGTCCTCCAGCTCGCGGGGCCGTACGCGGCCGCGAGAGCGCGAGCCGTGGCGGCTGCAAGCGCTTCCC
CTGGCACGACCGGCTCGGGCAGCATGCCGCTCGCCCTGCCGGGTCGTGCCACATCACAGGGGGGAGCTGGGCGCGGCGACGGGCGGAGAGGCGGGCGAGG
GACCTTGGCCAGCCAACGGGCGCGCGTGGGGGGCGGCGGACGTCTGGGGCCGTCGTGGCGGCCGGCGCTCGGCGGCGCTTCTTCGGCGGCCGGCCGTACG
GGCTGAGAAGGCTCCGTTTGTGGAAGCGTCGCCCGTACGGCCTGAGAGGCCAGCATTCGGCCGATAGTGGGGCCGAGTGGGGAGGGGTGCGCCGACCTCC
CGCCCGCACCAGCGGACCGTCCACTGTCGCCAGCGGACGGTGGATCCACCCGTGGATCCCCGAAACGACGCGAGGTCGTGGAGGCGGGGCGGGGCGTCTC
TTGGCCGGCAGCGGCCTCGAGGCGCGTGAGGGGTCGCGGTGCAATGGGCGCTGCGGGTCCCGGACCCGTGCCCGAAGTTGCAGCCGCTGAAGCGTCGCCG
GTGCCGAGCAGCGGCACCGCGCGTGGAGGCTCTCGGGGTCCGTTTCGGGCCCGGAAAGGGCCAAAACGGGGGCGAGCGGATCCACAGTGTGTAACCGCAC
CCCTAGTGGATCCGCCCACCCGTCCACTGCGCCACCGACCAGCCCACTCTCGTCACCGACCGCGCTGTAAAAAGACGCGTCGCTGGCGAGACTGGATTGG
CTGGCTGTGGAGCACTCGCTGTCGGTGGACAGTGAGCGCTCCCTGATTGGCCAAAAGAACCGCATCGCTGCGATCCTATTGGTCAAAAAGGGTAAAGGGA
CAATGGAGGACGCAACGCGGACCGAGGAGGACAGCCGAGGAGGAAAGGTAGGTAGAAAAGATCAAATGTAGTTGGCCTCGCGGGGGAAAGGTGAAAGCCC
CCGGAAACCGTCTCGCACAGCAAGCGCCACAAGAGCCCAAAAATGAATGTGAAAAAGACCAACGAAAAACGTCGGAAACCAGTTTTCACACTGATTAGAA
CAGATACTACACTTGATCTTAGCCAAAAGGCCGAGAAGGTATGATTATCGTTCTAGATAGAGCTTTCTCCTTATAGTAGTTAATACCCTCACGAGCATGT
GTTTGTTTAAGTATATTATTATTCTCTAATATATGGTAAAATAGCATACCTATCCCCTACCGGTTTTTTTAAGAGTGATTCTAGCCTTCTAAGAAATTAA
AATTGCGATTATAGTCTACATTTTCGGTAGCTGGGCTGAAGTGCTGCCAAACGATGCACCGCAGCTCCTTCCTCTTTGCAGCTCGAAAGTGCTGTTCCAA
AACCCCGTACGCTATCAAACTACACATTCCTATGCAGTCAGCCCGAATGCAAGAAAGTCAACCCCTGCATCGCTCGCTAGTCGCCCGCACGGGTACCTTC
CTTAATAATCACAAACCAATCAGACGCCTCGTTCCTGCCAAACAGTTTCAAGCAGATGTCGGAGAGAGCGGAGCGACTCTCGGGCCTGCAGAATGGCGTC
GTGGGCTCCATCGCCGGCATGATCGAAGTGATTCTGCAGCAGCCTACTGTGGCCATCAAGAACGCGGTACAGCAGGGCCGCCCCATCGCGTGGTCCGCGC
CAGCGCTCTACCGCGGCGTGGGCGTCTCGCTGGCATCCATTGCGCCCGTGAGCGCCATCCAGTTCGCAGTCAACGGCCGGTTGCTGCGCGGCCTCACAGC
CCGGGCGCGGCGCCATCAGACCAGACGAAGGTCCTGTGTGGCACGCTGTCGGGTGTCGCGTCGGCGGTGCTGAGCGCCTCCGCGGAGCTCGTCATGACGC
TGCAGCAGAACAACGGCAAGAGTTTCGGCGCCACCGTCAAGGAGGTGGCCGGCAGCACGGCGTGCGCGGCTATTGCGCGGCTTCACGGTCACGGCTGTGC
GAGACGCCGTGTGGTGCGCCGGGTACTTGGCTCTGGGTCCCGTGTTCACGCGCGAGATGCACACGCTGAGCCCCGCCACCTTCGGACACGTGGACACCGC
CACCAAGTCGCAGAAGGCCTCGGCCTCGATCGCCGGCTGCGTCACCGCCGGACTGATCACCGTGGTGGCCACGCAGCCCGTGGACACGGTCAAGACGGTC
ATGCAGGGCGAGGCCATGGCACTACCTGCGGGTCGCGCACCCAGCTCTCTCGCCACCGCCGCTCGCATCTACCGCGAAGGAGGCTTGGCGCGGTTCTACA
GCGGCATCGTGCCGAGAGGATGTCGCTTGGTCGGTGCCGTGTTTATCCTGGGCCAGGCGCGCATCCGGCTCGAAGAGGTCTTCGAGGAGCACGAGCTGCT
CAAGTTCTAAAAGCACGTAGGCGCACCATAAAGCGCTCGGGTAGATGATAATCCAACGAGCACAACACGATTCCAACCAGCGGCGCCAGTTCTCCATTGA
TGTGGTGTCAGTAGTCGAACAGCAAGTGACGTGGTTATCTTGATGCAGCGATTGGACAAGTGCACAAACAGCTGCAGGAACTTCACTTTGAGGTCACTTG
CAGATTCGCGGCCAAGATGACGGAGCGGGCGCAGAGACTCACGGCACTGCAGAACGGGGCCGTGGGGTCCCTCGCCGGGATGATCGAGATGACGATCCAG
CAGCCGTGGGTGGGCGTCAAGAACGCTGTGCAGCAAGGTCGCGCCGTGCCCCGATCGGTTCCGGCGCTCTACCGGGGCCTGGGGTGTCCCTGTCGTCCAT
TGCGCCCGTGAGCGCCATCCGCTTCGCCATCAACGGGCGACTGCTGCGCGTCCTGAGCGGGACCGACTCGGCACCGACGGACCAGGTCAAGGTACTGTGT
AGCACAGTCTCCGGCGCAACGGCCGCGGTGATCACGGGCCCGGCGGAGCTCGTCATGACACTGCAGCAGAACAACGGGAGGAGCTTCGGCGCGACCGTGA
AAGCGGTGGTGGAGACCCACGGAGCCTCGAGACTCGTGCGGGGCTACCCGGCCACAGCTCTACGCGACGCCGTCTGGTGCGCCGGCTACTTGGCTCTGGG
GCCGCTGTTCACGCGCGAGGTGCACGGCCTGAGACCTCAGACGTTCGGCCACTATGACACAGCTACGACGTCGCAGAAAGCTTCGGCCTCCATCGCAGGA
TGTTTGGCTGCTGGACTCGTGGTGGTGCCTCTCACGCAGCCAGTGGATACGATTAAGACAGTGATGCAGGGAGAGGCCATGAAACTGCCATCGGGTCGAG
GACCTGGTGTGCTCGCCACGGCCAAGCGCATTTACAGGGAAGGAGGAGCTCGGCGATTCTACCGCGGCATTGTGGCGCGTGGAAGTCGCCTCGTTGGGGC
CGTGTTCATTCTCGGACAAGCTCGCATGCGGCTCGAGGAGCTCTTCGAAGACCACGATCTGCTGAGGTTCGACGTTGGCGCCAACTATGAGCCGTGAGTG
ACGGAATGAAAGAGAACACGCACCAAGGAGTCAGTCGTATCCTATGGCAACTCGCTTCTTGCTGCGTGCCAGAAAGCATTTCGCAACAACAGTGGTTTGC
TATTGAGTGTCATGTGCCTAGTCTGTTTTCGTGTTTCTTGCGGCTTACGAGAGCGTGCAATGGCATCCTGCCACGCGAATCATTTGTTGCCCTGATTCCT
CTGCTGGCGGTGTGGCCTGGTGC