Description :
From Genome Similarity Track
Location :
Scaffold_164:5440- 13707
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_164-snap-gene-0.8Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_164-snap-gene-0.16Hypothetical leucine rich repeat calmodulin binding protein
Pytiw_DAOMBR242034maker-piw_contig_164-snap-gene-0.17UPF0139 membrane protein

Sequence
8267 bases(100 bases per row)
GTGGCTATGGTCGCGGCCCGTAACAAGTTCTTATTGTCCGCTATTTGTTGTCGATTTGGTGGTCTCCTGAGGATTTTGGGATATATAGTTGATATGGTCA
GAAATGATTCATGGGTGTCACTTCACTTACTTGGCCGTGCTTGATCCGCTCGAGAAGCGCCTTGGCCACACGCAGTGGCTCGATTGCGCTCTCTATTGCA
GAGATCTCCATGTGCGGGACGTTGAGCTGCTCGCAGAACGCGTGGATGGCTCGTGTTGAAGCACTACAAGTAGCAGTAGTTGCGTCGCGCTTGAGGTCGC
GCTTGGTGCCCACGACCACAGCGGGGAGCTTGCTGTGCTCCAGAAAGGTGCGCACGAATTGCCACGAGCGCTCTTGGTGGAGCTCGCTCTCAAGACTGTA
GACGAGCGCGATGCCCTGGGCGCCAGAGACGTAGCGCTCGAGTATCGCCTCGCCAGCGAAGAGCTGGGACGGCACGTCCCACACCTGCAGACATCCAGGC
ACGTCGGACAGTCACACTAGTGTATAATCAGCCGATATATATGACTGGCAACACGCACCTCAATGACGACGGGAGACATTCCTTCGAGGTGCATGAGCTT
GGCGCCAATGTTCACTGGAAGTTGGATCATGCGACATATTCCGTAATGATGACCAAACGGAGGCTCCAACCTACAGTTGGGAGTTGTCCACGCACCTGAG
GTGGACGCAGGAGGTGGAGAGCTGTCGTCATAAGTGCTCTCGTGACGAGCCACAGGGTCGCCCATGAGCCGCCGGAAGAGCATTGTTTTACCCACGCCAC
TGGCCCCAAGAAGCACGACCTTGACCTTCTCGGTCGTCTCGGTGGGGCCTTCAGTACGGGCCTTTCGATGGCGCACGCGACTCGCTTTGATGGGATTCAC
ACACAAGCAGTAGCAAGTAGCAACACACACACGTGAGTGTCTAGAGTTGGCTAGGGATGTGAGTAAGAGCGCGTGGTTAGATCGCAGGCGCCAGACCATT
TGCGCCCATTCGTGAGTGCGAATGCTTCAGGAAGTGCCCTTTCAAGCACATTTCTGAATTTAGAAAACATTTTATTTAAACAAAGCATCTTTTTCATTCG
TTAGCAAATCCGATACATTTCTGATTCTTCACAAGAGATCAAAGCAAACCAGCAGCTCAAGATGGACGAGAAGGGCAGGAGTCTGCAGACGCAGCTGCAG
TTCATGGAGCGCAACGGCCGCGCGCTCGAGGAGCTCGTCGCCAAGATGCTGCGCGTGCGCGAGGAGCAGGAGAGCTTCCTCGCGGCCTTCGCGCGGTCGC
TGCAGGACATGGGCGCGCAGGAGGAGAGCAGCGAGATCGCCCAGTGCCTCACGAGCCTCGGCGAGTGCAGCGGCAAGCTCGCGGCCGAGACCCACGACGT
GATGCTGCAGCGACCCGAGAGCGAGTTGCTGCTCACGCTCACGCAGATCCAGGACTGGGGCGTCGTGCCCATGAAGGTGTGGTGACGACTGTGGTAATGG
CTGGCTAGTAGGCATAGGTACTGACCGACTGGCTCGTAATATGTAGCGACTGCTGGAAGATCGGGAGAAGGCGCTCAAGATCGAAGGCAGGCTGCAGAAG
GAGTACGACGAAAAGGTTAGGCGACGTCTCTCTGTTTTGTGTGGGTGGACACTGTGAGCTTTTCTGATTGTGGGTTGGCGTGGGCTTGTTTTTGGTAGCG
CGGCGGGTCAGCTAAGGAGAAGGAGAAGAAACTGCGCATGCTCTCGGACCAGAAGCGCCGCGTGGAGAACGTCAACTTGCTGATCGACTACCACATGCGC
AGGTTTGAAGAGTTCCGTCTCGTCAAGATGAAGGTACCAAGCCTGCGCTTCTTGAGCAAGGTGCTTGCTGCTGAGATGGTATCATGACCCTGATCTGCTC
TGGACCTTTGCTTCGCTGCGATAGAAAATCATGGGCGAAATGGCGCGCTCCAACATGTTCTACCACGCAAAGGGTCTTGAGCTCTTCTCCGTGCCCTGCG
CGCAGATCTCGACGCTGCAGGCTCGCGCCCACGGAGAGGTGCCGTTAGTTCCGGTGACATGATTTGCAGGCTCTGGTGGTAACCTTTGGCTTGTTTCCCT
TCGACTGTGGTGCTTGCAGGATTGACGAGCTTGGATGTCGCTTGGTCGACCAACGGGGCGCTATTATCGCGTTGGGTCCAAGCGGATGCCAACACTGTAT
GTCGGTCGCGTCAGGATATCAGCTTGTTTGTTGGGCGGCGCAGTCAGTAATATGTCGTGCTTGCCACTGGATCGGTCCACGAGGTCTCGCCTGTGGCAAC
ATTGTAGTAGTACGCGTTGCCATCACTGTCGTACACGATCTGCCAGTCAGTTGTAGCCGCAACTATGCCACCATTGTCTGTATTTAAAGCTGTCTCCGCG
GGATTCGTCCAACTCGTCTCGCCGGTCTGCTCGTTAAAGTAGAAAGTGTTGCCGGCGTCGTCCACGAACGCAGTCCATGGACTTACACTCGAACGAGTTG
TGTCAGCAGCAGTTGACTCGGACTCTCCCACTGGCACGCTGTCGACACCATCTCCAGAACACTCGTATCCGGATATCACTGGCTCAACAGTGTTGCGCTC
CTGCATCTGAGCGCCCACATTCGTCGAAGTCAGATCCTGAGCAGCCTCTGGTTGTATGACATGGGAACTTTGACGGCCGGCAGCCTTGCTTTCCTCCCTC
CTGGTTGTCTTCTTATCAGCGACAACCTGGCTCTGCTCCCTTAAGAAGATCTGCTGCACGAGTGCGTCAACTTTCTTCCAGTCCTTCTCGGCGATCGCGC
TCTCCAGCCAGCTCATGTGCGACTCGCGCGCAGAGTACGGCACTGGCACTTCTCGCAGCTGCTTGACCTGGGCGTGGAGCGCAAGCGAGATCTGGTCGTC
GCTGTCGGAGGTGTCTCGCGCACTGCGAGGCGAGAGCGACCAGCGGGTCTCGCCCGTGATTGCGTTGTAGTAGTACGTGTTCTGCGTCTCCGGGTCGACA
TACTCGACCCACTTCTTGCCCAGCGCTCGCTTCTTCACAGAGCGTGACGTCAGCACGCGAGAGCTCGTAAGAGCATCCTCCATACTCCTCCCACTCGTCT
GCTGGGACTTGAACCACTCTCTCGACGAGTTTAGTTGGCTCACAAACTGCTCGTACGTTGCACTGAAGTCCTCGGGTTTCTCCCAGCGGTACTCGTTCGT
CAGCACGTTGAAGAAGTACATCAAGCCGCTCTCAGGGTCCAAGTGCTCGGTCCATACTGGTCGCTGCTGGCTGCTTTGCACGAGCTTCCCACTCGCATCA
TACTCGTAACCGTAGCGATATTGCCAATGCAGCGGTCGGGCGGATGCTGTAGACCCGTCGCCACTGTAGTTCACGCTTCTCGCTGAGCGCCGCGTCGAGG
GCATCGCGACGGATGTGTTAGCGCTAATAGACGCGTGGATACTGCGTGGCGAGACCGAGGCTCGCACTTCACGCGTGAGAGGGTGATAGAAGAAGAAGTG
CTCGCTGATCGGCTCGACGCGCTTTTCCCACTGATCCAGCAGCGAGCCCTTGACAATCGTCGTCGCGAGCAGCTCATCCAAGTCATCCAGTTGCTCGTCG
ATCCACTCTTTGCGCTTTCGTGACGAAAGGCTTTCAGTAAAGAATGACGTCTCCAGGTTTGCTGGCTTGTCCCACTGGTATTCCTTGGTACCGCTGTGAA
AGTAGTAGGTCGACTGGAGTTTTTCATCGAAGGCTTCATACCACGCGCCATCTGTACGCCCGCTTGACGACAGTGAGCTGCCTGTAGCCAGCGCCTGCAC
CTCTTCTTCTTGGCTCCCCACAGTACCTTGATGGGCATCATCCATCGCTATCGGCTTTGCAAACTCGTCGTGAAAGATGTCCATCGCGAGTGGACGACTC
CAGCGCGCCACACCGGTGAACGCGTTGTAGTAGTACTCTCGTGCAGGAGCGCCATTCTCCTCCGTTGTCCACATGCGGATCCAGCAATTTCCGCCTTCGT
GTACGGCGCAGCGCACACGGTATCCACGAAAGATGCGCTGGATAGCAGTCGCAGCACGGCGCTGATGGCGCACCGTCTCCTGCAATCGCTTGCTGCGGTT
CTCTTTGGTCTTCTTGATGACACCGTCGGTGAGTGGCTCGAGCGCGCGCTTCACGACTCGGAGCTGCTTTTCCGTGTCGTTCAGCGCTGTACTCAACGTC
TTCATGTTGCGTGCATCCAGTGCGATCTCGATCCGTTTCGCGCGCAGCTGATCCGCTAGCTGCACTTGGAGGTACTGGGTCAAGTACCGCTGTGGCGTGC
CTGTGATGCGACTCGAGTCGTGGTACTTGGTCTTGATTTTCATGGTTTTCTCGAGCTCTAGCGTCAACGTGCGCTCCTCGTCCTCGTCAGCGTGCATCTT
GCGACCGAGGCTCTCAACTCTGTCGCGCTGGTCGTCCACGAGTGCTGCGAGCCGCGCTTCTTTCGCAAAGAGCGGCTTTGCCTGCGCTTCGAGCTTGCGT
AACTCACGCTGCACCTCGCACTCAGCGCGACCACGATGTCCTCTGAGTACTCTCTGGATGTTTGTTGCAGCGAGCAAACGCTTGCGCTGCGCGATCATGG
TCAGCTTCATGGTTTTCATAAACCCGCGAGACATGTGCATTCGGTAGGCCGCTTGAATGGCGTGGGCAGCCTGATGTTCGCGCGCCCGCAGCTTGATGAG
CCCGAGGAGCACAGCAGACAAGTGCTTTTGGCGAATCCCTCGCCAGTACCTCTGGATCGTCATTGCAGCGTTGATGAGCTGCAGATCCTTCGCCTCTTCT
CGCAGGATGAGCGCATTGCGCCTTCCTCGGTGACCTCGGAACACTTTCTGCATTTTGGTGGCCCCGTCGTGCTGTTGCTTCTTGTACAAAAGCTCTGCGA
GTCGCTGTGCGCGAGCTTGACGCCCTCGATGACCACGATACACTCGCTGGAGGTACATGGCCGACTGCTTCTCCTTCTCCACTTGCCGGCGCTTTGCCTC
GCGAGCGGCGTTGAGCATCGCTGCGTCCGATCGACCGCGATGACCGCGGTATGCACGCTGTAGCTTGATTGTAGCAATCTCTTTCATGACGTGGATGCGG
GCTTCGAGCTGTCTCTGTCGATGGATCTCGTCACGCATCATGCGCACTCGCTTACGACCCTGGAAGCCTCGGAACAGCTTCTGAAAGATGAGCGCTGCTT
CTTCTTCGTGTTCACGGATCCTGCGCAAGCGCTTGGCTCTTGCAAGCATGCGTCGCAGCTGTAGGTTGCGATACTCCCGACCGATGACCCTCGCTGCGCT
GTCCTCCAAGATGTATTGCTTCTCGAGCGCTAGCCGCTTGCGCACGAGGAATCCGCGGATTTTCGCTTGGATCTTTGGCAGAATGCGCTTCTCGACGTAT
TTGAGCTTTGCCTCCCAGAGCCCACCACGCGAGATGCATCCACGCATCGCAGACTGGATCTTGATCGCGCTTCGGAGCTCGAGCAGCTTTCGATCGCGCA
CTTGACACAGCTCGGCGGCATTTGGCAGCGGCTGGAAGCCAAAGAAAGTCGATGCCCACTCGACAAACTCGAGCTTGTAGATCAGCTTTTGCAGGAAGCG
GCGGCCGATTTGCTCGCAGCCAGTGAGGTCGAGTGTGACGAGGTTTGTGCACGCGCTCGTGAGCGCATCAACGCCCGACTCTGTGATCCGCGGACAATTG
GCGAGCGAAAGCGTTGCAAGCGGCTTGGAAACCGTACTCCTCGCGAGCTCGTTGAGTGCCGTGTCGCTGATTCGCTGGCAGTCGGCGAGGCTCAAGTACG
TCAGTTTTTTGCAGTGCTGCGCCAGCGCTCGCACACCGTGGGTGTCGATGTTTGGGCTCCCGCTGATATCGAGCCAGCTTATGTTGGAGCACTTTGTGGC
AATGTCGCTCAGGTCCTGGTTTGTTGTCTTGATGCACCCTGCCAGTGAGAGCGTCTGTAGCTGATGGCACTGGCTCGCGAGGGCGCGGATCGCGACGCTG
GTCACGTCTCGACAGCCCGTCAGCTTCAACGTTGTGAGCAGCGGGCATCTACGCGCGATTGCACGCAGCCCAGCGTCGTGGACATGGCGACAGCCAAAGA
GGTCCAATACCGTGAGCTTTGGACAGTACTTGCCGATCTCCACGAGCGCCTTGTCGCCGTACTCGCCCACGTGCTCGCACTCGGAGACGTCCAAGTGGCG
CAAGTCCTTGCAACACTGCGCGATTTTGACGATTCCGGCGTCCGTGATCCGCTGGCAGCGCTTGATGATGAACGTCTGGATCATCCAGCAGCCCGCGGCG
AGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCAGTCACTTAGATCCACGACCACAAGCTGGCAGTTGTGCGCTAATAGGCGCAGTCCCAGCTCTGTCACACGCTCACACTGCGCCAAG
TAAATCGTGTCGAGCTTGCTGCACTGCCTTGCGATTGCCCAAATCCCTGCGTCCGTGATCTGCGCGCAGCCGGTCAGCCTGAGGCCGCGCAGAGTCGGCA
CTGTGTTGACCACCTCTTGGAGCGTTGCGTCCGTCACTGTGATGCCCGTGTCCAGCGCGTGTTGCTGAAGGTCGATCACGGGCTGGAAGCGTCCGCTCTC
GTCGGCTAAAAAGTTCTGCAGGAACGAGCGCATCTGCCGCTGCTGTCGCTCTTGCACAGGCATCATTGGTGTGGCTCCACCACCACTGCCGTTGCTGTGG
ATGGGCGGTAGGACGCAAGAACTGCTGCTGCTGGGATCGGCATTGGCATGGCGGTGAGGAGATCTCGGTCGCTTCATCAACTTGTGGCGGAACGTAATCG
CATCCGAAGAACTCGTGGCGTTCTTGAGTTGCTCGTGGTCATCATCGCGTGGGGACGATCGGTATCCATCTTGAGTTTGATGCCACGCGAGTGACGGTGC
TCGTTCGGGGCTTCGTGGTGGCAGACGTGCTGGAGAAGTCCGGTCTTTCATCGTCTTGGACTGGAGCTCGCGGCTTTGGTGTCACTCATTCGCACTGCTT
GGTGCTGCGTCTGTCAGCAGCCCATTGAGTCGCATGAGGTGAGTTCGGAATGCAGGATTTATATATGGCTCGGGCTATTATTACTTGTTATCGAGCGCGG
GGGGACGATGGCGGAAGCGTACGTCTGTATGAGATTCAACCAGCCACACGCACAGTCAATACCCCCATTTGCGCCATCGGCATGAACTACGTACTCGGCA
ATCACTCGCGACAATAAGCACCGTCGTCATCTCTACGTGGTGACGCTTGCTATGGAATCATCGCGGTGGCTAGGGCGCTGCTTCGAGCGACGCAGTGCCA
GCCGAGACGGGGAACGTGACTGTGGAGCTCTGGTCGCCCGAGTACGCCGACACGAGCGACATGGACGCGAACATGATGGACATGGAAAGCGACTTGACGT
CCGAGTCGAGGCTGCGCATGTTGATGAACGACGCGCCGCAGAAAATGAAGCAGCACCACGCCAGCGCCTTCCACTAAACACACAATACACATCACATTGT
TAGTACCAGTACGTACACATACCTAGCGACGGCCATACACACACACACACAGGCATGATTAACATTGGTACCTTGAGCACGAAGCTGAGCGAACCGAGCA
GCAGCGAGAGCAGCGAGTACCAGTCCGTCGGATCGTTGCTCGTGTCCAGCGGCTCGCGGATGAACGAGTGCACCTCGGCGGGGCGGCGCGGGTCTCCACT
GGCGGCCGACATGCTTGCTACTACAGAACTAGTACACTGCTCGTCTTGCTTGTGTTGCGAGAATGCGGAATTGGGCTATTGCAGTACCGCGTAACCCAGG
GGTACGAAAGGTTGACACGCGTTAAAGAGTCCACTATAAAAAGTTATTCGCAGCGTTTATGCACGATATTAACTATGCAAATACATAGAGATATCTTCTA
TTGAAGTCGGATACGGTACACTGGTGTAACAAGGTTACTATGGTTGAAGCCGCTGCGTGAGCACGAGAGTGTCCATGTGGAACGCGTCGATGTACGCAAG
GAAGGCACCGGTGGAGGCGTCCGCCTGCGCGTCCTGCAACAGCTACATAGGTACATAGGCGTCAGTT