Description :
From Genome Similarity Track
Location :
scaffold_27:5440- 21291
Transcript NameFunction/comments
g1345.t1 hypothetical protein PHYSODRAFT_323450
g1346.t1 hypothetical protein PHYSODRAFT_469105
g1347.t1 pyruvate dehydrogenase [lipoamide]
g1348.t1hypothetical protein

Sequence
15851 bases(100 bases per row)
TGGGGAACCTTCCTGAAGAAGCTGCACTTCTTTCTGGACCATGGGACCGCGGGATTCGCGCTCGCTTGGCTGCATGATGGCTCCCACTTTATCGTTCACC
ACTCAAAGGAAGTTGAGCTGACAAAGCAATTGGGACTGCGAGCCTGCTCGCTTCATCAAGTGCTGGAGACACTGGGTTTCGAGTGCCAAGAGGAGAATGA
CTGGGAGTACACAATCTATCGTCACAGCTGCTTCATGCTCGGGAACCCAGAAAAGATCGAGGAGATATTGGGTTACGAGGCGTTGTTCCCCAGCACCAGC
ACTGATCAGGCTGTGGCGATGCCCAGCATCGCGTACAGCTCCGAGTTGAAACCATTGGAAGTCCGGCTGAGTCTTCCGGATTCGTACTCACAGTCTTGGG
AGGTTACTGTTGCGCCGAGCGTCCTGCCACATCCAACTTTCGACGCCACGGAGATGTTGCTTGACGAGAGTGCTGCATTCGCTAACAACTCTGAGGAACG
TTCGTGGGGAAGTATGCTCGACACCACGGACGAGCGGAGTGATCCCGACATAAATTCCCCGCTGTGGTGGTCTCAGCGCAGTGATTTCTCAAGTATTTGC
TCAGACGACCTGTCCGACATGGACACACTCTCTCAGATCAGCTCGTTCTTCTGCTAAAACGTGACAATGTAGCAGTCAGATAACGATATGAAACAACACT
GTGGTCGATGAGCTAAGTCGTCTATATCATCACGGAAGGAAGGAACATCAGCTTGGGGAAAATTGTGTACTTAGGCTGGAACCAGGCAGCCCTTGTTGAT
GTGCATATGAAGTATTCCTTCTACCTTACACGGAGTTCTTGCGCTGAAAGTTAGCGTCAGGGTCAGATCGATCGCCACTCAAGCTTTCATCCTCAGTCAT
CGCCACCTGCACCGAGTTGAGCGGAGCAGCTGATGACGGTACTGCGTCGCCCGTGTTCAGCGCTACAGAGCCATCGTTAGCGTCGCTGGAGACGTCAACT
CCGTAGAAGTCATAGATAGTCTTCACCGTGACCTCCGAGTCCTTGTGGTTAATGTCCTTGTGGTAGGCCTCAAACGTCAGCCAAAACAGCGGCACGATGT
ACAGCGCAGAGAACACATCAAGTGTGTAGTGCTTGCGCGATGCCACAATCAGGAACGCGATAGCGATCTGGACGCACACCATGATGGTGATTCCGTACTT
GTTGGGCCAGTACTTCCAGACCGTGAGAATGAGTGACACAGTGTAAATTGTGTGCGAGCTGAACATCAAGTCGCCGCAGCCGTTGAGCGAGTCCAGGCGC
GTGAACCACTCGCTGACGGTGGGCGGGTTGAATTCCGGGTTGGGGATGACGCACGACACTGGGTCGTCCGGGTTCGCGGCCAAGCACGTGTCGTTAAACT
TCAGCTCACAGTGAGCGGCTGGGGACGGCAGGGCCGTGACGAGGAACGAGATGCAGCGGAAGATCAGACAGATGCTAAGCTGCAGCAAGCAGCGCTTGAG
CACGATCACGAGGTAGCGCGGACGGCCAGGCTCCTGTCGGAAGAGCGGGATCGTCAGAACCAGGATGATGGCTGGGCCAAAGACGGCCGCGAACACGAGA
ATGTCCGAGATGGAGGCGGCAGTGCCGGTCAGTTCCGGCATGAGCTCATAGCCCAGGTCATAGAGCGTGAAGCGCTGCTCTGTCGAGAGGTAGTGGCCCT
GGATGTAATAGGCCAGGTTGTGGAAGATGGCGTGGACGTACTGCATGATGACGCACGGCAGGATGATCTTCCACTCCTGGGCCAGCAGCTGCAGCTCGAT
CTTCACATAATTAATGAAGCTTTCCTTGTCACGGAGCTGCCAACGCCTCCCCATTCTGTCGATAGTGTTTTAGTTGATAAAACTGAACGGTAGCGATTAA
ACTGTACATTTTACACCGAGACCAGAGTGAGTTTTTGGCCTAATTCCATGGAGATTTCAGGCCGGAGACGTACCTCGGAGCTGTGTGCTGCGTGCTGCCG
GTCTGGTTATCGAGTGACGCGTCCAGGGCTCCAAGGGACCTCCTCTTCCGCGTGTGGAACGGCGCTGAACGTGCGCGCTTGGGCTGCTGTTTGGTTGTGA
GAAGCGCTTTCCGCGGCCGCAAACAGGCCAAAATGGCGATTGCGCCTAACTATACCGACCGTCGAAACCGCTGACAAATAATACTTCGCAAAGTTCGTAC
TTCAATCATGACTCCTTTCTTCCCAATTAATATATTACATTAAATTGCATTATTAATATCCTGAATATGTCGATATCAATTTTGAACACTCTGTTCTGCG
GGGATTACGCACTTTGGTGATCATTTGGAGCGATGTTGTCGCAGATACCGACTTTGCTGTTGCCATCGGCTTCATGGCCTTCACTTTGCTCGATGCAACG
CAGGTTGCAGCAACATTGCACTGCCGTTATGACAGTCTTGACGCCATGTCACTGGTTGAAGATTTCCTCACTTCATAGTGCTCTGCGGTTGAAACGATCC
TAATGATAGGAAGGTGATGTCGGCAGTTTCGACGCTGAGCTCTTCCGACTGGATTTTCCTCCACTGCGTGCGACTCCGACGAGCATGAAGCGACTGGGGG
GTTCTTCGCTCCATGACGATGCGACTGGGCAAGAGCAAGAGCGAGGCGCGAACCTCCAACTTGCGCAGCGGCACCGCAAGATCGCCGCCGGCAGCTTCAA
AGGCCGCAAAGCGTTGGAGCCCGAGTTCGCTACACCTGGCGTGATAGGAAAGCTCACACTGAGCTTTACGACCTCCGGACCTTTGACGAAGCACACGAGG
ATCACGTGCCAATTGCCAGGGCACGGGTGGACGCTATCGACAGCTTCACCACCAAATGTCGTGCTCCAACTGCCGAATCCAAGCGAGCATGCGGTTACAG
CTGCACTACCGCAGGTGAAGATGAGCTGGAGCTCTTCGACCAGGACGATGGAGTTTACACTGTTGAACGAGAATGTGATACTGGCTGATACTCCACTGGT
GCTGGTAGTGTCGGGGGTTAGCACCCCGGAGAAAGCGACACCACAGGGTGAAGCTATCGTCACGAGCTTCGAGAAACTTGTCGTGAGGAACACCGTTCCA
GCGTCTAAACGCGGTGGTCAGGTTATTGATGGCCCCACTGCATTTACAATACCGAAGATTGTACCGGGGTCCATTGGTGGGGCAAAACGCTGGAGTCCGT
TTAATTGCTGTCCCGGAGCAGTGTCCGATGTGACATTGGCGTTTGCAGTCAATGGCAAGATTCCTTCGGGTGGGAAATTGTTGATTGAGCTCCCACCACA
CGGATGGGATATGGATGCACAGCCAAGAGTGCTGCTACGAACGCCAGCGCATCATAACAAAGCAATGACAGCTTCGTGGGACACCGATCAACACACTCTG
GAGATTTTCCTGGGCACCGATGGGACGTCTGTTGAAACAAGGACGAATGTGATTCTCACGATTTCAATGGTAAAGAATCCCCAAAAGGAAACGATGTTTT
TGGCCGCTTCGAACGACGCATCAACTTCCGCAGCTCGTCTTACCACGTTGTCGGCCAGTGGCGGCGTGATTGACGGCCCCAGTCGAGTTGATGTAGCGCG
AATTAGCGAGCTCCGTGAACGCGATTTCGACGTACTTACCAAAGTACTTGACGCAGATGCAGCAGAGAACCCGTCGGCTGCTGAAAACGGCATCGCTGTT
GACCGCGTGCCACATTTATTACGACGGGCAGGTCTCAAGTTGTCTGACGAACTGTATCAGTCACTTGTGGTTCCTTGCTTCCCAGTACGCCACGATCCTC
CAGTTATTCAGCCCGATAGCAGTGAAGCTCTACCAGCAGACAACACAGCTGAAGTATTACCCACCACGCCACCTGATGGTTATTTATCCCGCGAAGAACT
GCTCAATGTGTTTGCTCTTGTGTATGCTCCGGCTTATAAATACGGTCAGGAGCTGCGCTTGGCGTGTGGTCGAGGTCACGTCGACCTTGTGAGGGAATGG
ATTAGTCAGGGTTGTAACCCGAACGCTGGAGACGCTTCCGGGTGGTCAGCGCTGCATTACGCGGCTGACTATTGTCAGCTGGACGTGATCAACCTCCTCG
TCGAAATGACCACAGAAAACGACACCAACGACGAGACCAAAACCTCAACACTGGAAGTCAACGCTCGAGACGGTCACGGATGGACGCCGCTTATGTGTGC
AGCAGCCAACGGCCACGTCGACGTCATACAGAGGCTTCTAGCTCTCGGCGCAGACGTCTCGTTGACTAGCGCTGAACATCGCTCCGCACTTCACTGGGCA
GCAAGTCGAGGAATGGCTACAGCAGTATCTGAGCTCCTCGCTGCCGGTGCTGACGCATGCCAAGCGGATCGTTGTGGCTGGACACCTTTACACTGCGCGA
TGCTGCATGGCAACAACACGTGTACAGCCATTCTCACTGATAAAGGCGCCGATCCAGCGGCGACAGACTCATTGGGCTACATGGCTCAGTTCTACTGCGA
CGCATTTCTCTCTATAGATGGCCAACAAGTCTGAGTCACTTCAACATTGCTGTAATTGGGTAAAACGCTGTCTCCAAATCTTTTTCTGGTGGTCAAAAAA
TGCTTGCGCAAACGCGTCCTATTTTCCACCAATAACAGCGACTTTGAAGTGTTCTAGCGAATCCCATTGCAGTCCACAAGAACTTGACCTCTTCCAGGAG
CTCCAGTGTCCAAGGTCTCATTCCCCAAGTCTCTTAGCCATGCCCACGTCCGCAGGAGCTAAAGTTCTGGCTGAGGTGTACCGCCTGCACCACATCCCGC
TGCCGCCCATCACGCTGCAGACGCTGCTGAAGCGCGGGCCCCATGCAAGTCCCGTCATTGCTGCGTCACTGCAGAACGATCCGCAGGCTCTTACCAAATG
GCGCGAAGTGAATGCGCCCGCCATCGTCACATCCGCTCAACTGCTGCACCGCGAGGCGCCGATCCGCATTGCACGCCGCATTGTGGACCTCGAGAACCTG
CCGGACGAGCTGCCGCAAGCTAAGCCCATTGTGTCACTGCGCGAGCAGCTGTTGGACAGCTTCGACCAGCTCACGAGCTGCCCGCTGCCTGCCAACCTCG
CGAGCGAGCGCGACTTTGTGGAGCTGCACCGTAAGATCCGCAAGGAACACGCCACGATGCACGGCAACATCGCTGAGGCCGTGCAGGCGCTCGAGTACGA
GCCCCAAGGCCTGAGCGAGTCGCTTGACAACTTCTACAACTCTCGTATTGGCATCCGGATGCTTGTGGACCAGCATGTTGCGGCACAGACGCCTAAGCCT
GGCTTCACGGGAATCGTGAACGATGAGACCTCACCAGTTAAGATCGCCCGGGACATTGTGCACAAGGTGCATCCTCTTTGGCAGGACAGTCTCAACGGTG
AACAACTTCCGGAGATCATTGTCAGTGGGGACGAAGAAGCCACCTATCGCTACGTGCCGCAGCACATTGAGATCATCTTGACGGAGGTATTCAAGAACGC
GGTGCTGAACAGCGTCGCGGCTGCCAAGAGGACGGGAGCTACGACGCCTCCACCTATTAACGTGCTGATCTCCGGTGGACCTCATGGCGTGTGTGTCAAG
GTGTCGGATCTGGGTGGTGGTATGACTCGCAAGGAGGCCAACGCGCTGGCGAACTACTACCACACGGCCACATCCCCGTCCTCGAGCGGCTACGACCCCG
TCGCAGATGTCTTGGAGAGACGTGCTAGTGGACTGGACTTCTCGGATTCGTTCGGCTTGCGTATTGCCCAGCTTTACGCCAAATACTTCGGTGGAGAGCT
GGCGATCATGCCTATGGAGGGCCACGGCGTGGACACGTATATTTACATGAACTGCCTCACTGGCGCCTCGGAGCTCAAGTAAGTTAGGTAGTGGTTCAGA
CTTAAGCAGGTTGAAAAAAAATGCAGTGTGCATGGTGGTCAGTTGCTTCTTCATGTTCTACCTGTCCAGATTCCAAGTACTTTATTAGCAAAAACGGTTT
CCTATTTACACGTGGGGCACTACCTAATGTCATGTACAGTCTTCCATTTCGGCTGCTTGTTGTGGACGCTTTAGATCTGCAAGACGCCGTTCGAGGCGAC
CAATACGACTTGAGTCCACCTGGAGTCGTCGAGGAGTCCGACAGCCAACCTCTGTGGAAGTCGAAAGTGTAAGTGCCGTGAAAACTGGAGCTTGACACCG
AAACTAACAATTGTCTGTTGCAGTAACACCACATTTCCGCAAGAGCTGGGGTTGATTTTGTTATCTGCTCAACCTGCGACGGTTAAATCTCTTTGTGTAG
CAGTAGAACTTGCCAGGGCTCCAGCTCAGAGTAAGTGTTGCAAAGGAAGATTTGGCTTTATAAGTTGGAAAAACTAACAGTAGCTTAGTTGAAGTTTTTG
CAGCATTACCACAACGACATACAAGAGCAAACGCGTTGAATCATCTTGATGCTGTATCTCGTTATCTTAGCGCTGACTGGAAGCAATGTTGGTAAGCGTA
AATGTGCTGTACATTGTACAAGGGTGAATGCTGACTTCAATCGACAGTGACCCTTTAGTTTGGGGAGAGTGTCCATCAGAAAGTTTAAACACATTTCGGG
AAATCGACACTAGGGTCGCTCAACTGGGCGTATCCGAGTGTTCATTCATCAAACTCGTTATCCAAGCGCCGCACAGAGGCAATTTGTCTCGGCAGGTACT
AATATTGGTAAACCCAAATGGAATTCGCGCTGATAACCTTTGCATCGCTACAGATTTTGCTGGAAGATATTGAAATATTAGGATCGACAGAAGATCAGAA
TCCGAGTGACGTTAAACGTATCGACGGTCGAATCAACCGTCGTCGTCCCCCAACACATCGACCAGCGCTGTTTACCCCGGGCAATGATTACGACGAACTA
CAGTCAGTGTTGCTGGATGCTGGGGTGCCGATGGACCTGGTAGTACAAGTTGCCAACGTTTCTAACAGTGCAACTGGAATTCCATCTCCAACTCCGCAGC
AAAATGGTAGGGATGCTTTTATCCTAGAATTGAGTTCTCAGGGCATACCTGCTGAGATTTCTGGCGCTACTCTGGTATCGAAAGAAAGTAGCAACCAGGA
CAGCGAGAGGAATCCTGCTTCACCTTTTGACCGAGTATTACGGCAGTATGTGGAACAAACTGCTCGTGAGAGAGCTACGCTTCAGGAGATTCTTGCCACG
GAGATACGTTCAGGTGCAGATGAAGTGTCTTCATGGCAGTCATCGACGATATCACCGACTGATCCAGTAAACAGCATTGAGATCGTGCTGTACACTTTTG
GAATATTTTTCACGCAGTGCTTACTCTGCGGTGGGGCTGATATTCAAGTAACCTGTATACAACTGGTGGAACGTACCGTTCCTCTTTTGAAACAAGCTCT
TGGTGCAACCACTGCGTTTGAAGGTCTGACCGCTCTGATTGTTCTCGGAGTTCGAGCAGCAAATACATCTCGAGCTTTCCAATCTGTAATGCACTTAGCA
TACACTGTATTCCAGACCGAGGTGTCACGAGAGAAGAAAGATTCAAAGGAAGTGGAAGTTCAAATTGGAGGTCGTAAAAATGACGCGCAATTAAGACTGA
TTGAGGAAGTTGCCTGTGCTAATTGGAGTTACGGCCTGCGAATCATCCTGGAGCGGACTCTTGCCAATCCAGTTTGTTGGTCCACGAGTTACACTGGGAA
GGCAACACCGCCGTCGGTCAATAGAGAGTTCCTGCAGTTTGTTCGCTTACTGGTCAATCAAGATGAAACTCGCACGAATTTCTTCAATGAGCTTCTTGAT
TTATTTCCTACTGGAAACGCTGTAGGTCTGACTGTCGAACAGAATCGATTGCGACTGCTGCGTCTGGTGCTGCGCAATGACCTATTTTGCTGTCATCTAA
CAGTAAATGTTAAAACAAGGATCCAAAACCTTTGCACCAAGATTTTGGACCCATCAAGCGATAACTTGCCGTTGAAAATCGGTGATAAGGGCATAATGTC
TCGTTTGGCGTCCGAGTGTTTAGCTAAACTTGAAGAGCTTGTTTCGGGTTCTCAAAACTTATGTCGTACCAACGAATTGGCCACCATTTACAGACACCTG
GAAGTCTCGAACAATTCACACAGTCACCATTCACATCGCTATTCTCACACTCCCTTCTTCATCCAAGATCCACTATCGGACGCCGAGGTGACGGTATTTG
GCGAGCAGTTGCAGCGGTATTTCTCCATTGTACCTCGTCCAAATGCTCTTTATCGACATTCGTTTGTACGTGCGAGCCAAACCGAACGTGAATCTTTCCA
AAAGGGCAACATTGCTTTCCAAGGACAGGTTGTTGAACGAGAACCACCAAAGGAAACATTTCACCAAGAACTCCAAAGAAAAACGGCGCCATTCGTGTTT
AATATCAGCGACAAGAAGCCGATAACGGAGTTGTCGTCGGTGCCTTCGGATAAGCAAGAAATCGTGTCAAGTTTTGCTGCTTTTAAAGGCATCATAGAAC
GACGAAGTGATCCCCCAAGACGATCGAACAAGGTCTCTCCAGCACAAGAGAAGCAAACTCCACCAGTTTCTAAAGCTACAACAGTGGCAAACGACCAGTT
CGTGACAAGTGCTGACACTGCAGTAAATGCTTTACCGACCGGGACTTCTGAAAAGATCTTAGCAACAGAAACGACACGTATTCCAGATATTTTGACTGCA
AGTAAAACTCCTCGTGCGAGTCAAACGTCACGTGCAACAACTCAACAATCGACAACCTCCCTGGTACGTAATTTTCCAGGGTCAATTGCAGCTACCGAAC
AGAAGTCGACACGACCGGAAAACACAATACAGTTGAAAGCTAATCCGAACGATGGCAAGACTAAAAAGAAAGGCAAAGAGAAGACCAAAACGAGTGGCAA
AAACGGTGGCAAAGACCCGGATAATTGCGTACTCCAATGAACTCCTTCAAATTATTCACGAGTTGATTTTGTATCGCCGCTGATTCTCCAAAGGAAGCTT
CTGGACGTAATTTTTCAGGACAAATTGTTCGTCAACGTCAATACAGAGTGCAAGCACTAATTGTTTAGCAGCATCGCGAACCAAGGCGTTCTGGTGTTGG
TCTGCATCACTATGGAGCAGGAAGTGAATAATCCTCCGAGGAGCAATATCGCAGCTTGCACAACAGTGAAATGACAATAAAAGTGCTGTCAAAAGTTTCA
ACAGAGCCAGGAGCTGCTGGTCGGTCAGCTGAACATGATTTCTCTCGACACTTTTTAGAAGCAGATGCGTCACGAACGTGCCTCTAGTGCGTGCGGATCC
AGCAATCTGAACCAATTGATCAACAGTAACCGTGAATTTGTAGATCGTCAAAAGAAAAGGAATTTCGTTACCTTCAAAAGTGTAAACGCAGCTGCATCGC
GTATGGATGCCTCGTGAGAAGAGAGCCTTTCCAGTAGAGTATCCGCAATATCGACAAGCTGTAACACAGTACCATGTGCATGAGTTTACAGTTAGTTTCT
CGTTCGCGAGTTCTTTCAAAGGCAAAAATACTAACATCCGTTTTTGAAGACACCGTATCTTGGAAGTATGGTGAATAGCTCAGCAGCATTTGCAAGAAAG
CACAACCGGCAACAAACACTTGGGCGTTCGAATCCTTTAGTGCGGTGATCAGTACCTCAGTAATTTCTGTATCCACCGTTGCGAGTTGGAAACCTGGTCG
GTCCTCTCCTCCGAAATCTCGTTGTGGGCACTTAACAAGCTTCCATAATAGTGCCTCCTTTTCTTGCCATTGTCCAGTCCGTAACTTGTTTAGCACATCA
TTAACATTGAGTCCTCGAAGCGCAAGAGATGCCTTTCCGTCGCTGCTGAGTGGCTGATTTTTCGACGAAGAAACAAGCTGGGAAAATCTCTCTTCTTCAC
GCTGTCTGCGCTGTTCAAGTCCCTCAAATTTCCCCAGCGCATAGCCCACAGTCGTATGTACCTGGTGTTTGTTTTCTATTAAATCCATCAACTTGTTGGC
TTCTTGTTCCAGTAAGACCCACGGTTGCATTAGTTTGTCATCACCAGCGAATTGAGCTAGTTGCTTGCCAATCTGAATATCAGCACAAACTTGCTCGGGT
GACTTGTGTACTCGAGAATCTTCCGCCCTGATATTCGCAGCACGTGGTGATTTAACGGCAACTTGTAGCACTGGTCCAGACGTAGTTGTATCATAAACAA
AAAGGTTTCGTTGACGAGGCGACTGGATGATTTTATCTGGGCTCTTCCTCGGCGATGATATCATGGGCAGTACCAGATATGTGTCCTTCGGAGCCCCCAG
TGCTACTACAGATGCCAGTCCAACTTGACTGAAGAGATTGGTTCGTGTTTGATGGCAAGAATGCAGCACCAAACGCAAAAGAGTGATTTTAGCGGTGGGT
CGAGGCATCTGAACCTCTTGAAGCTCGCATGCGGTGAGGTTAATGCTCTCACTATTGAGAAAAGATACAAAACCAAGCCTTTCAAACCTCACCCCAGTCT
TGGCATTGTGAATTCCATCACTCGCAGCTGAAGACGTGAAAATTTCAATTCGAGTCGCCACTTTGAAGGGATGAGAGAGCAAATTGACTTGCTCAATACG
CGCCGCAATCCCTCGATTGACTCGGAATACCAGCTCCTGCGGAAACTCGCAGAACTTCTCGGATTCCCACACAGCGAGTTGGGAGCCATGGGGACGCGCC
AGGTTCGTCGCAGGGAAGTACTCGTCCTCGCTCGAGCAGAAAACTAGCTCCAGAACAGCGGGTTTCTTCCCATTATTCATTTTTTAAACTAAAACTAAAT
TTATCTGTAAAGTGACGAACACTCCTGTTGGGAGTGCACGTCTTCAAGTTGCCTTTTATCTCATTCCATTTGACAGTTTTTCAGAATGATGGTACCATAT
ACGTGGTGCACATCACTTGACAACTTTTGTTCCAGAAGGTCTCAAGTCATAAAAATTTTGTTGACCAAAATGCCGACACTGAGCGACGAGGAGCAGGAGC
TGATCCAGAAGGACCGAGAGGCCAACCCAGGCTGTTTCTACTCGACGGCGCTATCCCAGTCCTGCAGATCAATCAATGGCGACAGCAAGTGCGAGATCAT
CAAGAAGATCTTCCGCCAATGCCCGAATACACGCAAAGAGCTCATCTCGAACCGCAAGGAGATCACAGAGGACGAGCACGGGGGAGAAGCTGCAGCTGGA
GACTTTTTCAATAGGGAGAGAATGGATCCTCGTAAAGGGTACGTTCATGCTTGCGATAATGTCGATTGTTTTTGGGTAAACGTTGAAAAAATCCCTGTGA
ATTCTACAAATTCAGCGGCGAACAGGAATTCGGCAACTTTTTCCAGCAACGGTGAGTGAAGATGGTTCATCGAGAGGTGACACTGAGGATTTACCGGTAG
TTGGCTAACGTTTAGTGGATTATGGCACAGAGGCGACGATTTCGAGGCCCAAATGAGTCCATTCGACTTTTTAAGACAAGAAATGCTGCGTCCGTTTGAA
GGTACGTCACACGTTTTGATGTTAATACTTCGAAAGGTAGTATTAGTAGTGCTGATCGTATTTTGTTTCAGACTTCTTTGGTGGTAGCTTGCTGGGGAGA
GGCGACTCAAACCCGTTTGAAGGGCTTGAGGAGTTTGAGCGAATGCCGGTGCGTCCGCCGTCGCCGACACCGCATCGACCATCGCGCCAGGCACCGTCGA
ACCCGCCACATTACTCGTTCCAGCCTTCCCAGGGCAGAAGTTCCGATGGTATGTTGTGTGATCAGTTGAGAAGGCTGGGTTGGTGAGGATTCTAACGTTC
TCGATGCTTTTGCTGTGAAGAAACCAACGCAAAAGAGCGCGCACAAGGCAAGAGCGACATGTTCGCAGACTACTCCGGTCGCGTGGAGGAGATATAGGAA
TTGCTTGGCAGGCGTAGCGGTTCTAAGCGGTGCGGTCTGAATTATTATGCCCATGACCGTTCTTGGGTGAACTCGATGAGGTTTCTTTGTTGAATAGACA
ACAAAGTTGTGGGATAAGGCGACTTGCTCTCAGCTGATAGTATCCGGATACTTTATACAATACGGTAGCCATTTTACGTGACGTGACGGTCACGTGCAAG
CCACGGAAAGTGAACATGAGGGAAGTGACGTTGGGATTGCATTTTTAACGACATGCATCTCAAATGAACAACTTCATGTTACAGGAGTGCACGTACGGCA
CTACATGTACAAAAGAATTATCAATGACGCGCTGTGTTGTGCTGCAGGATCGCAAGTTATTAACGCATGCACTCCAAGTACTTTCGGATACAGCAGTAAA
TTTATGATTTTTAGCTGCTACCCCACATTCGCGATAAGACGAAGTCCGAAACTTCTGTCATGACTCATTCCATGAAAAAACAAATCGAAAAAAATCAGGA
TTCCCCAGGAAGGATACTTTCCAGGAAAGGCGATCTTGCGTTGGTGTCGATGGCTCATTTCGGATTTTGCGGTGAAAACCCAAGGTTAATGGGTGATGTC
GGGACTGCATTTGCAGCGACATTAGAGCGAATTGGGACAAAATTGACGCCCGAGGATCTCACAAAGCTCTACCCGACCCCACAACATGAGACAAAAACGT
TGCTCGTGTTGGAAGATTGCAAGTTCTTCGAGCTATTCGATGAGGATCCTGTGGAGGCCTGCAAGATGACGGAGCGTCTACGCGAACAAGTGGAGCAGCA
GCACGGTACTTCGTACATGAGTCAGATTCTGATGTCAACGACCCACCACCCGCTTAAGAGGATGCAAACTACCGATTACCGTCTCACACGAGGGGAAAAG
GCCAAGCTTGCGTCTAATGGAGTCGTTGCGGTGGAGCGCATGTCGGCTAAGAGCTTTGCGGAAATCTACTATTGCCTCTACACGGATGACATGCCGGTGT
TTGTGACAGCAGACTCGGTGCTGCATGCGTGGCACCGCAGCTTTGACGCTTTTCTAGTGGAGGCGGAGGTCCAGGTACTGTCGCCTACACTGGATAAAGT
GCTGGAATCGACACTTTCTAAATGCACTGAGGCCATCTCTGCTGCTCCGAAGCGAGACAATGACAAGAGAAAAGCGATGGTAGATGTTGAGCTCTTTCTC
CGAGTAGCACTCAGCCTCTTGCGAGGAAAACCAGCCGACGGTATCTCTGGGAACACGAACAAGCTAGGGCGTTTGCTAGAATTCATCTGCAAGGAGGAGA
CAACCAAGACCGAGATATTCTCGGCCAAGCGTGAAGTCGATTTTTCACAGTTTAAACCTCGTGGACACTACACAAAATCCGAGAAGCTGATGCGGTATTT
CCGATCCATGATGTGGCTCGGGACGATCGACTTCCGTATCGCAGGTGATGAAAACCCAAAGGTACATCTTCATCAGCTACTCTGCGCAGTTTTGTTGGTG
AATTGCCTACAGGAGTCAAAAATGATGGAGATTGTGGAGGGCGTTGACGCGTTGATTTCCAGCCTAGTGGCCGATGGAGGAATGGGTGCTGACTCACTCT
CGCCTGCTCGACTTGCTCAATTACTATCAGTGGACGCTAAACCTTCTGACCCAAACCCCTTGAAGAGTTTTCAGAACCTGATCCTTCAGAAAGGAGTTGG
GACCCAACAAATCAACGGCCACCCTCGAACTGAGAATGATGAACTCCTATGGTCTACAACATCGACGACTCCACCGACCTCATTCGCTCTTCTTGGACAG
CGGTTTGTCTGGAGCTCCTTCATCTTCTCGCGGTTAGTCTATGACCAGGTTCTCTTCGAAGATGAAAAGCAAAAGCGACGCATTCCAAGCGCAGTTGATG
TTGCCTTCACCCTCTTTGGCAACGATAGTGCTGCTCAAGTCTTAACAGATCGAATGAATGCTGAACCACAGAAGAATTCTGGTGTTGGTTCTCCGGAGTT
CGTTCTGTTCCGCGATGGCATCCCGTTCTCGTCGAATCTTGTGGCATTGCGTCAACTGTTGGACAAGGAATTTGACGACGAAGACGACAGAAGTCCACCG
GATTTGAATGGCAAATCAAGTATAAGCATGCTATGGCAACGAGCTTTACGTGCCCTGTCACGACCGTCTCCGAACCCATCGAGCACATTCCGGTCGAATG
TTTGGCGTTTGCGCCAAATGAATACGCAGCTGGGGTCGTTCACTCAACTACGACATGACACCTTGCTTTACGCGAAGCAAGCTTATTCGATAAGGGGTGG
CTGTGAGTATGCAGACGGTATGGTGGACCCGTATCCGCTCTTCTGGCGGCGAATGGGAGAACTTGCTCAGCAAATGACTACCGTGGTTGAGAATGTGCTG
ACGCCATTGGTCGAGTTTTCTCTTGGACATTCAACAGATTCGCGGCCCAGTTGGGGCCCGCCCTTGAGCAAGAGATTGGAGTCTAAAAGCCAAAACTTTT
TCCTCTCTTTTGCGAAAACGATGCAGTCGCTTGAAGAGATTGCACGTCTCCAAGCTGACCACCAGCCCTTACTCGATGATCAAGTGAACTTCTTGAAGAC
AGTCATGGAAGAGCGATTTGGAAGTGGTGGATCGAGATACTGCGGATGGTACCCAGGACTATTCTTTGAAAGCCGTGAAGACTCAGGCAAGAGCGATGTT
ATCGTAGCGGACGTCCACACAGACTCACCATCGCCTGAGCACATGGACCCAGGAGGTGTGCTTCATCTGGGTGTTGGAAAACCACTGATGGCATTCTTCG
TCGTGGACAATACCATGTTTGCAGGCCCAGTGTTCAGCAGTTATGAGTTCGTGACACCAATCGACAATCGTTTGACGGACGAGGAGTTCGAACGCAAACT
GCCATCAATGCGGATGCCTGAGTGGGCGCATCGATCGTATTTGTGCTAGGAGAGTTCCAGACAGCACGTTTTCTTTTTATCTTTTTACTAGTAGTTGTGC
CGCGAGTGGTTGAGGGCTAGTTGAAGACCATGATGTAGGTATCTACAGTTGACATCGAACGCCAGTCCTTGTTGGAAAGCTCTGCTGGCCTCCGCAAACC
TCTCAAGACCACAAAGTGCACAACCTTTACGGTAGTATCCCTAATGGAACGAGCTAGTTAATAGTGACTCGGAATAACAAAACAATAAAAACATTTCACG
TACCACAGTTGACTTTGGGTCCAGCAGAACAACCTGCTCTGCGTCTTGTAGTGCTGCTGAGTAGTTTCCCATAGCTGCCAAGAGCGTCGAGCGCCTTGTG
TACATTATACCCAGGTTCTTTCGCGTTTCCGTATTTAAACGGATGATTTTGTTATAAAACTCGAGCATTTCCTCCGCTTCTTGTAGTGGAAGTGTCATTA
TTGAGTCAAGTGCCAGCAAAGTTTGTGAAAATCCCTTCTTTTCAACGTTTTCCGAAATATCACCAGTCCGAGGACGTGCTGTGTTCTTGGAGTATAGAGA
AGGTAGCAGTGAAATACTGGCTTCGCTAGTAAAGTTGTGCTGGTGACGAAGGGAACTGGTGCTTTTAGACGCTCGTAGCAGCACAGAATCAAGTTCTTCA
CCTGATTTAACTGTTGGATGCTTCGGAGAAGACAGCAATGTCATAGACTTGGTCAATGGCGAGTTTTGCTCGGCAAGTAAGGCCATTTTCTGGGAAAACT
CGATCGACTCAAGGTGCGGCCGTGAGTTTCGCAGCGTTAATTTGTGCGCATCACAAACACCTTCGTTGTATCGACCTCTCTTTGTGGCAGCAACGCAGTC
ACACCCGAGAAATCCAGGAGTGGCAAACGTTTTAGTCACCACAGTTGTTGAGTTTGGACGATGTCGAGCCACCTGGCTATCACGAAAGTCATCCAGGAGA
GGATCACGCGAAGCTTCGTCGCTAGACTCCACTGTAATAGCAGGAATGTCT