Description :
From Genome Similarity Track
Location :
Scaffold_1595:544- 2180
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_1595-abinit-gene-0.0Gene of unknown function

Sequence
1636 bases(100 bases per row)
GTCGACCTTCACCATACCAAACTCACTTTTtGGCAAgCTAAtCGACAACCCCcACCGTTCACACGTGTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNACAATTCgAACTCGTAGGCAAGCTCACCACCCAACGTCAACTTCaCCTTGGCCTTTCCTTCAGTCGGGTACACAGACCCACCGAC
ACCAGAGCAGTtcAGCTGCTCCaGGTGTCCACGTAGATGCCAGACTTACGCGCAAAGTCTGAATCCAAGATAGACACCTCCGCACCAGAGTCAAGActCT
CGCTTGGCTGTCGTCGTCATAGCGGGTACGAtCGTGTGCCTTCTGGGCGAAGTGCCTCCAATAGCCACGaCGCTCTCCAGGgTgCAACACCAACTTTTGA
ACCAACCTCTCTCACACATACTCGTCTCGTGGATTTCCATCTTGCGTGTGTATTTGTTCCTTAGGTAGTCGCCTACCGTCCTGTACAACATATGCGTACA
CACACACTTGGTCGGGATGACGCTCGTCGCGTACCAGCCCCGCGGCTGgCGAGCGCATCAGTTTAACCACTTCTCCACCGCGGACGGCcGGAGACCAGCA
TGCTGGGTtGGATTGTACCACGATTTGAGCAGATTGGTAACTTCCTCAAGGCGGAtGgCCCCGAAGTCGTGCACCGCAGCCCTTGCAACgcTGGTAGCAA
TACTCGGTCGGATGACCTTTCTTACCACACGCTGTG