Description :
From Genome Similarity Track
Location :
Scaffold_29:543993- 552647
Sequence
8654 bases(100 bases per row)
CTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAGAACTACTAAGGCAAGGGAACACACCCGCAAGGCAACTCTACGGCCAG
ATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCC
CATCCCCACGTCTCGCCAAGACACTCAAGCTTTACCACTTGAACTCTTCGGAAGTTACCGGGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGA
GGAAAGTTCAGCAGAGCACGGATCATCGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCACAGTTGATAAGTTGTACCTGGTAATCTCGCAGATTTTGCTG
ATCCCGCTTCATCACAATGGTGAGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGG
GAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGAAGGAACTCTGTCGACGGAAGAG
AGGTGGATCCGGATTCGGATCTAGAAGAGAAACCTCGTATCCTCCTCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCAAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAAAACCGTACCTAAGCCCAACCCCGCTAGTCGAAGAAACGAGAA
AGAAGACGAAAACGAGTAAGACTACGCGAAAGAAGATGCAAGTTCTAGAGTCGGAAGAAGACCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGC
CACCAAGCTTTACGCGACTTTCTGCATCAAGATCCTGTCATGCATATCCTGAATCCACGACAGATCGACGAACCAAGGGAACCGGTGAGAGCACCAATGA
AAACGGCGAGCAAGTTGGTGGCAGTCAAAGATCTATTAAGTTTGCTTAAGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCT
AGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAATTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCACCG
AGGATCAGCAAAGCTGCATCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGAGG
CATCCATGCTGCAAGCGCGGGCGATGATCCGGGGACAGGAAGTCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACCCGTGATGTGATACAATC
CAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCGTCAGATCGGACTCAAGGTAATCGCCTCACGGATCCTGTCTCGCCAGTGGACCAG
CCGGCCACAGGCTCTTCCGACACCTCCTCAGGCACCCTGCAGCGACATTTCGAAGCTGCCATGAGTCGCTTCCTGGCCGAACAGGGTATGAGAACTCCTG
AGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGAGAGACAACTCCCATGATGAGTTCGACCCAGATGATCT
GGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAACCATATCGGAT
CTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGGACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTG
AGAAGTGTTTGACCTTTGCAGATCTGTTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCG
CAGTTTCCAGACCCAGTACTGTGGATTAAGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACATACAT
CGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAG
GTGCGGATCTGGCCTACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCTGTGGATCGCGCGAAACACCGCCAGAA
GTAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCCGCTCGACGTGTCCACCAAGTCACGGCGCCCGACACAGGAACT
GAATCAGGATCCGACGGTTCGGACTCCGACCCTGAGGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAACTCTC
GACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCTCGAGATATCATGGACGGGACAGCACAAGTCAGGTGTTTGCAGTGCGAATCCCGGAA
GCACACTGAATCTGTATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAGGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGC
GAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGTCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGGGG
CTGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTATGTACTGCATTAATGCATTTGTGAACAAGACATCGCTA
GACCCAGGTAGCACGACCCTAGACCCAGTCGATAATACACGTGATCTACATGACGTGGCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATTAGTTTT
CCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTCACTGGGAGAAGCGTCAACATGGTCGATGGTTTGAGCCTACCAAGGG
TGAGGTCACTGCGGATCCCCCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTGGGATCCATGGATCTGCTAACCGGGGAGTCCCGAAAT
ACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATAAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGA
GGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTATGCCGT
ACGAACGGGAGAACGCGGATCAAGATCACGTTGGCAGGTTGTTTGGTGTACTGGTTTGATATTTGGGTTGGAGATCGCGCTGGACAAGACGTCATCCTCG
GGATGAATTTCATGGTACCAGCCGGAGTGAGGTTGGAACTGGCGGATGGGACATTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGTGGACGGCGACC
GTTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATACTACGACCTGGATCGAGCCCGGAGAGACCTGGGAACTGCCAGATCGGTTAAAGTGGGTGGAG
CATGAGAAAAGGTGGGTCATTCGGGGCGTGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACA
AGTGACTATTACGGGACCATTATGAAGAGATCGGGCGATGGTTGGTGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTA
CAAAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCAAATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGG
CCTTCATATCAAACTCCGCGAAAGATCCTGCAGAGGAATCGTCGGATGAGAGCCAAGCGATGGATTGGATCCACGACGGGGGATGATCCCCAGCGTCGTC
CCCTAGATAACGCAGGATCGGTGGATGAAGGATCGCAGAGGGCTGAAGCCGGACCGCCCGATCCTGCTGACCCACAAGTGGATCCAAGCTTTCCATTGGA
TTAAGTGCCTGGATCCTTGTCGAGAGTGGCCGCACTAGCTAAACAGGAACCATCGTGGGTAAACCCACCAGATGATTAAGTCGACCCAAAAGGTGGCTTC
CCCAGTACCAGGATTCCCGACCCCACGAAGACAGAAGTGATGACGGTTGAAGGAGTGTCGCGGTGCTTGGATCCAAGGGGTGAACCGACAAAGACTGAAG
ATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTTGGAGAATGCATGGCGGTGATCCCGGAAGTACCACTGACCACAGGGGAGGT
CACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCGCTGAAGTGGATCGGCTACCTTCAAAGAATCTGGGAAAGCCGACATCTGCTGATTGG
TAAAGGTAATGCGTTACTGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCAATCGCTCAAAGGGTGCGGAAGGAGGCACCT
CAGCTCCAAGAAAAACTATCGGATCTGGTTAAGATCCTGCTGCAAGCCAAGATCATCAGGTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCA
TCAAGAAGAACGGGTTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACAGCCTTGATTTCCATTGATTGCGCATTCCGATGCCCTCTAACTAATA
AGCTGTTTGGAATTATTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCGG
CTTTGTTGAGATCCGCGTTGTCTCCTTAGCTACCTGCTGAGCTGGAAATAATTCGGCGGCTGAAAAAGTAACATGTTTCTATAGAAGTCGCGTAATAATT
TCCTTGAACTCTTTATCATCAATCATTCGATTGCTGTACATATCCACACTAAACGATTTAAGTTGCTTAACGATTGAAAGATTATCACTTCCGAGTTCGA
GTTCATCTTTTAGCTTAGCATATTCAACTTTTAGAGCTTCTAACGGATCCTCAACCCGATCATGGAAATTGTACGGAAGTAACCTCCCTACTGGAGGCGT
GTACTAAGTGGAACCTCTCTATCAGTGTGGTGAAGAGCGATTGGGGGATGCGCAAGGTAAATTACTTAGGCCATCGAGTCTCCAAGGAGGGATTGGAGGC
GAATCCTAAGGACGTGTCTTCGTTAGCCGACTTGTCCTTCCCACAGTCGTTGCGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTC
ATCGAGGATTACGCTCTGTTTGCCGCGGTATTGTATGAACTGAGAGAGGTAGATTTTGCTGCGATGACCACTGCAGCTGTCCGGATCAAAATCCAACAAG
CTCTGGCCCTGGAGATGTCGGATCCACGAAGCGATCCAAGTAGCACGACGCCAGAAGAGAACCTAAAACAGGAGTTGGATTCACCCCGGGACCAAAAGAA
AGAGGATCCAATCAGGATAGAGACGACAGAGGGGAGCTCGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGG
ATCGCGACCACACCTATCCTCCGTCATTTTGATCCGGAACGTCAACCTACGGTGATAGTTTAAGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTACAAA
AACATGAGGGGATCTGTCATCCAGTCACTTTCGTCAGTCGGACACTGAAGCCGAACGAACTGAACTACGGAGCGGTGGAGAAGGAAATACTCGCGCTCCT
GCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGGAGAATCCATCCCGGGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAT
ACAACGAAGACGCCCGTCCACATCAAATCCACGGTGGGATCGCAGATGTGGCTTTATTTGGATCGAGTGAACGAATGGTACGCCCGCAAATTGGCCCATC
TATGGCATGGACCGTTCCAGGTGAGCAAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAAGAACCGAATATCGCCTGTTCCCTGTAGTACACGT
ATCCAAGCTGAGGTTGGTCAAAGAATACCCAGATCGGCCGCAAACCCGTCTTTGGGTGGATGGAACCGACCGGGTAGACTTCGACGAAGTCCTCCTACCG
GAGGATAGTTGGAATGTGGATCTCGAGGCCAACGAGTTCGAGGTCGAGAAGATCACCGACATGAGGTCAGGGAAGCGAGCTAGATACGGGCGGATTTACC
GCGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAATTGTGGAGCATTATTCTATGATGTCTTGCGGGATCG
TACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAGG