Description :
From Genome Similarity Track
Location :
Scaffold_5:5438329- 5441782
Transcript NameFunction/comments
Physo_304103Hypothetical protein

Sequence
3453 bases(100 bases per row)
GATTTCGTTACCAAGATATTCCGGAAGGTGTGCGGACGTTCAAGATGCTGACAACGTCGCAGCAAGTGAATTTGAAGTCTCAAGAACGAGTTGATGCGTA
CTGCTGCCTGTTGCCTTGTTGGTCAAAGAAGGATTTGTGGTCAACTTTGCCACTAAGGATATGGAAGAACGGTTCTACTACTCTGGCGGAAGCGTGCGTG
AATTTACACTTGCTACATCGGAGGACGTACGCAGTGCAATTGATGATGCGATCAGTGGTGTGGATGATATCTCAAACGTACTCTCGAACAACTCCGGTGT
ATTGACGGGATCGCAAGTTGATCGATTGCGCCATACATTCGTGAAAGATGCTGATGACACAAATCATTTTATCGCCAGGCGAAATTGGAATATGCCGTTC
TTACACTCTCTATCCGGCTGCGATCGGACGCGCTGTTTCGAATCTATGCATGGGCTCGAAGCACCGGACATGAATCACTTGAATACGATCCACTGACGTA
TAGGAAACCAGATGAACCTCGTGGTTATGAATTCAAGCCCGTGCTCCTCAAAAACGGTACTGCTGTTCAACGGGGAACCTAAAGTGAGTATAAGCCTTAT
TTGGAAGAATGGCGGGACAATGACGAGCTCGCGTATTGGTTTCCTGCGTGCGATAATTTCCCCAATATTGACAGCATTGTGAAGCTTGAGTCAGGCGGCG
TGGCGTACCTTCAAGTGACTGTCGCAGAACAGCATGCCACCTGCAGTACTCAACTGAAAGAGATGCATGCGATATTCGGTCTCGCGAATTCGGCCAAGCC
ACCAATCTACATACCGATTTGTCCCGACCGAAAGTCATGCCAAGAGTTTGTTCTCACCTCGCGCACTGAAACTTTATTATTGACGTGTCAAGTGTTTGTG
GGCTACTTTGAGGAGTATCAGCTCATCTGCGGCAGATGGCCCGAAGAACAACTTTTCGGTGAAACCAGTCCCTCCCGAGCACACATACAACACAACGTAC
GGCGTCGATGTGCTAACCGAACTCTTTGTTCTCGACTTGATAAAACGATCCCCCCAAAGTGCGTCCGATTCGAAGATGAAAATTCCCGAATTCGCAGTTC
GTTTAGAACTGTCGTTACATGCAAGTTTTTGTCAGATACCGGTACAAATCAATTTGGAGTGACCTCGTGTTTGCCATCGCTGCACTGGTCCTCGTCTTTG
GTGCGGCTTTCTTCCACTGCTCCGCCTCGGACAAGTCCATCTACGCTCGACCCAGCAGCAACAGCAATGGAGAAGGTTACAGCAGTGCCAGCACTACGTC
GAGCAGCTTTCCTGGAAGCCCCAACTACGGTTTGTCTCTGTCGTCTTCGATTCCTGAGCTGCGCGATGAAGAGGAGAGCCTGCTTGAAAACCAAATGTGA
GTATGTACATGTTCACTTGTAGCAATGATGCTGGGCGGATGCATACAGGTGTGAAACAGGAGACTTTGGCATTTAATGATCATTTTGGCGCATCCTGTAC
CTACCTAACGCTATCTTCTGAAGCTGGTGATGAGAAATCTCTTCACTTGGGCAATTATTTTGCATTTCGACAAACAGATCGGTGGCCGCTACCCAGTTCT
CACGCTGTTCCTCTGCGTAGATTCGTTGGATGTAGCTCTCAGCATCAGGAAAGACGCGATAGGCGCTGGCATCCTGCATAGTGGCGAATATTGGAGCGAC
AAGCTGATGTTCTCCTGCATGGTTGCACATCTGCATGACTCGATTAAACACGGCAATGCTGGGCGGAATACCAAACATTGCCTGCATATCGGGAAGCATC
CGAACAGCGCGACGCCATTCGCCGACTTTCTCCAACGAGTCCAATAACTGAGTGACGACAAAAACTGGCGGAAGTTGGCCCGTCGCGGTGTGCCACTTGT
GAAGCAGTGTCGGGACCTCGACCACGCGATCCTTGTCCTCCAAAGATGTGCATGCCACAAGATACGCTGAAAAGCTTGAGTCGCTCACGAGATCACTTTT
CAGCTCAACAGATTTCTTGTCCCGCTTGCGGTTGATAAGGGTGTCAAAAATGGTAATGACACCCTCGAAGTCCTCATTCACACTACACGCAGCTATCGCA
TGCTCATACGTCGTCATGTCAGGCTTCAATCGGTTCTGCTTCATTTCCTCCAGAAGCTCAATAATGCTTGCACGAGCCCAAGCAGCGTTTTCACGCTGTT
CATAATCGTAGTAGTGCGGTGACTCCACTGCGAAATCTTCACTAGTCTGGGCGAAAGCTTCATCGCTACTGTGAAGCTCGTCGCTCAGTTGTTCATCACC
ATCCTCGTCATAATCTACGACATCATCGTCTTCCTCCCAGTTGTTTCTGTTCTTCCTCCACCACGCAGCCCGCTCCCCAGCTCTAACGAAAGCTTCTAAT
GCTGTGTTGTAAGAAATGATGTCGGCGGTCACGGCACGCTTACGGCGGATCACATCCAGTACTTCAAGCGCACGTCCAGGAAGTGCCGCCTCGGAACATG
CCAACAGGATGCGGTTATAGATACTTACAGAGGCCCTACCAAGCTTTTCTTCCATCTCATTTGCGATATCCCAGGCACTAGATACATTTCCAACGCGAGC
ATATGCGAACACCAATGGCTCGTACGTTTCGATCGTCGGAGTAAATGCGCCTGATGTCTCAATTGCACGGAAGAGCTCCAGCGCGCCATCAGGGTTCTTT
GAATTTGCACACAATTGCATGGCTCCACTGAGTACCTTCAGAGTAGGCTTATAACCATCGGCAGCCATGATGTGATCCAAAAAGTTTAAGCCCACCTCAA
ATTGCTGTTGGCTTGCGCAGGTCGCGAACATCAGCCCCAATGTCGTATCATCCGGTTGAATCCCACGTTTCTTCATCAAGTCAAATAAAGCGAAAGCTGC
ATCCACCTCCCCGAGGTGGTGATAATAAGCGAACGCATTGTTAAACACGCCGACATCAAGTGAGCTGAGCGGTGCGTCACGGCAGGTATTGGTGATAAAC
TCCGCCATCCACGCCAACATTTCCAACTCTTGTCCGTCGATCACTTCTTCATCCCGGTCCTCGCCGCCTAGCAGGCCGTCATCGACATCGGTATTGCTGT
TTTCTGGACTCTCCAAGAACGTAGAAAATAACCGGAAGAGCGAATAGTATGTCGCGGCCCCTGAATCGACTTTCTGGTCTTCAGTGCACCATTCAAAGAA
CGAGAGACCTTCCATAACAATTTTGACCCGAGCGCGTGCATCCCTCCCACTACTCTTTAAATTTGCGGTGTGTGCCTTGAGTACCGTGTTCATAGTCACT
TGATCGGGTAGTAAATCACTTTCGATCATCTCGTTCAAAATTGAATCTATTTGACGAGCATCACCACGGACCGCACAGGCATTCAAAAGCGCATTGTAGC
TCCACGTCGTCGGTGTGCACTCCGGAGAAGACACGGCGTACTTCTTCATTTTT