Description :
From Genome Similarity Track
Location :
contig_42:543826- 557744
Transcript NameFunction/comments
g9138.t1hypothetical protein
g9139.t1hypothetical protein

Sequence
13918 bases(100 bases per row)
CCTTGTGGAGTGGTCACCTGAATGTATCCCTTAGTGCATGTTACACTACGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACAGTGAGACCCACCTTCA
ACAATCGAGCGTTGTAATAGCAATTATGCCATACTCGCTGTTGTCGGATCCATGGACGTCTTGGTTGCGCCGATCGTGAATTTCATTATGTTTTCCTTGA
TTGTTGCGGCAGGGATTTCCACGACGATCATGGCGTTTCCATTAGGAGAACGATTGTTGTTTTCACGACCATGGTAGTTGGTCCACGAGTTTTTTTTGCC
ATGGTTTCCCTTGTAGCTGCCTTTGAAAGGGTAATGACTTTGCGTGCCTTGTGTTGCCTTGAGCAGGAAGAGCCGTGTCAGTCTTGATTTCGCCATCACG
TAGGTGACGCTGCAGGATGCAGCGGTCGACTGTGTCGTGGTTGTCGCGCTGGCAGTACGTGCACTTCACTGAAGCCACGACAACTTTTTTTCATCTTGGT
GGGGACTCGGAGATTCGCTGGCATCGGAATTGGTGATATGGCTTGAACAGCTCTCTCAGCTCGTGTTTACTTAGACTGGGGTTTCTTGTCCGAGGATGTA
GCGATTGCGCGCTAGCTCATTCTGGACCTTGGTCTCGACGTGCCGTTTCAGGTCTTCGTACGGAATAAACTTCCGACTGCCTTTCCAGACTGCTAGTTCA
GGCTTCCACTCCGTTGGGAAGGAATGGTACAGACAGAGCGACCTTTGGTCGTCGCTCAGCACACTGTTCGTGGCTTCCGCGGCTGCCTTCATAGATTCAA
CCAAGTCAATGATGAAATCCATCCTTCCTCGTATTTGAGGGCCATCAGGTACGGCTGAATGTAGTACGGGTCACTGCGGATGGCAGCAACTTCGTACTCC
TTATCCTTCACCACGAGAACGTGTTGATCATCGATGGTTTTGATGAGGAAGGCTTTAGCCTTTGCTTCATCGAGCCGTAGATTCCTCGAGCTCAGTTTTA
GGCTCTTAGCCTCTAGCTTCTCCGCTCGCTTCAGATCATCACGCTTTTTAGCAGTGAATGACTGGATCAAGGGTGGTTGTATCTACCCCATTTCCACGTC
GCCGTCGTCTCCAACGGTGGCAGACTTCGAACTTGAGTCGTCCATGTCGTTGGCCTTGGGTGCCCCAACGGCGTCTAGCGCGGCCTTAATGTCCCTCATG
TCCGCCAATACCGGGTTGAGGTCTTCATCCGAGGAGAAGTCGTAGTCCTCGTCGCCCGCATAGTCGGCTTCGAGGGCGGCGGTCACTCGAGTGTTCCAGA
TCACGAAGTTCCGGCCACTGAGGCACGGAAAATCGTGGTCGTCGGTGCTTGAGTCAGTATTTGGGCTCATAGCCTGTCAAGGTCGTCGGAAGAGGAGCAG
CAGAGGTGAGACAGCTTATGTAACTAAGGGGTAAATTGGGCAACTTGGTAAATCCTACCTATAACCTAACCCCTCTTTCTTAAGACCCGCTTTTATGGGT
CAGATTGGCCAAAAGTCGGGAAAGGCACAATACTTCGAGCTTGCACCCAAAGTGCTCTTGGTTTTCTGGCTTTCCCATATTCCGTGTACTTCACATAAAC
CTCGTGTAGAGCTTGATACTTCCTCCGCGCGGGAATTATTGCAAGAATGTACTATCCACAGACCCAAGACTCTTGAAAGGAATTGCAGTAAAATATGATA
TTATGTAGGTACAACAGTAAGGAAGGCTCTCTCTCTCTATATTCGATCATACATCAATTACGACTCCTTCATGAAGAATGGCGACAGCGTAGCGAAATGC
CTCTAAATCGCATGGTAACGATTGGGGGAGCTTTCCTAGACGGCGCAGCTTGTCCTATCCGATGTGAGGAAGCTTGTACTCGTTCGAACCACCGGCGCGC
ATTGTACACTCGAAAACCTTCTGCAAGGTGAGAAAGATATTGTCCAGCTTCTCATGTTCGAGTGCGTCGTACGATTTCCTTACCGCACGAATAAGCTGGT
CGATGTTGTAGTAGTCTTCTTGATACTGGAGAGCTTGTATCGAAGAGAAGTATCCCAAATCAAGGGTATTATAATCTGGAGAGTTTGCCGGCTGAAACTC
GAGCTGAATGTTCCATCCGTCAGCACGCCCAGCGGCGAGGATATCTGGATCATTGGGTTTGCAGTGAGATGTAGCATTATCATGTTGGATGATGATTGGC
ATACCTTTCTCACAAATTGGCCACTTGGCCTTGATTGCTGGTATAACATGTTCAAGCAGGTAGCGCTTGTAGACTTTACCATTGGCAGAATCTGTAGCGG
GGCTACACATTCGGTTCACCTCCTACCGTAGTGTAACATGCACTAAGGGATACATTCAGGTGACCACTCCACAAGGTGGTCCACATTCATAGCCCAAAGC
ATATGACTGGTAGAAAGTAACATCTTTCTACCAATGAGGGCCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTTATTAGAAATAT
CAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAACTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGCGGAT
ACAAGTATACTGAACTTAAGTAAATAACTCCTACGCTTCCTCATACACGTGCGCACGCGTGTAAGCTTAAGCAGTGGGTCTAAGCAGACCCATTACAGAA
ACCAAGTTCTTCGTCCTGATCGTTCCTGCCAGTCGGTTCTTGCTGGTGCGCTGCGCTTCTGTTTGCTTCGTAAAATCCCAGATGCCAATTTTCCCGTCAA
ATAAAACCTGTCCATTTGCATCATATCTGCAAATAATAAAAACAATAAATATCAGAGACTGAACAAAATTGATAAGTTGTGCAGGTTACGTTTACCTTGG
TCTAGCTATTGCAGCCAGGAAAATTGTCTTGCCGATGAATCGCTTGCTTTTACGCTCGCGATGAGGCACGGTCTCCCCTGGCAGAACGTAGAAGGCCCTC
TTGTTTGTGTCCTCGTTGAACCACTTCTCGTCCACATGCACGACGTTGTACGGGGCGAGAAGTGGGAGCCATCAGATCCGTGGACCACGTGGCGAAGAGC
GTGCCGAATTCGAGCATGCTTGTTCTCGTTCGTCAAGAGCGGGTGGATGGTGTTGGTGTGGCGCAGGAGCTGGCCCTGCACGATCGCGTCCCACACCACA
GAGCGCGCTACGTCCAGCTCATCTGCCAGACACTGTTGTGTCATGCGCCGACGAAACGGAATGGTGGTGATGCGCGCTAAAAGCGCTTGCCGGTCTTTCT
TCTTGCGGCCGGCTGCCTCCGGCATCCTGCTAACCACGCCGTCGATCCCGTCGCTGGCAAATGCCGACTTAAACAGGCCCCAGACTCGGCTAATGGTGCT
GATGTCCACACTAAATTTCTCAGCAGCATGGCTCATGGCTCCTCTGTCGGGGCGACCGTGCTCACCGTTCAGCAGTAGAAAAATCATAGCATCCTTTCGC
TCTCTGTCGGTGAGGTTTGGCTTGGATGGCGTGGTTCGGGCGCTCATGCGGGGGGACTGGTTGCTGGTGGCGTGCTTGCGAGATGGGGTAATTTGGGTAA
TGAGGATGCCCCATGCGTACACTTTCGCTCGTAACTTTCTTGTTTGAAGGATTTTTTTGGCGCTCAAAAGACGCGCGAAAAGCTGAGAGCAAATGGCGTC
GATTCCGCCTATCAGCGGGCTCAAAGCGAGCCCATGAGGGAAAAAAGATCGGACCCATCTGTTTTTCGTTGCAATTATTTTCACCCAGAGGAAGTATGAC
ATTACCTTGTCATACTTGTGTGTTCTCTACGTAATGTATCCATTCCGCATTTGAATGGAGACCAAGGCTCCACTATACTCCGCGACAAGATAAATCACCC
ACCCTCGTTTGAGGGCACAGCTCTGTCAATATTACGAGTTAGCTATTGCTGTTTAGATATGCTTCTTCTGTCACCAATAGACCAACGTGGTTTGTGCTAA
CGATTGCAATTTCGCAGCGTGCGGGGGACCTCCAATACAAAATTCCATTTAAGCATAGCGACACATTAGATCACCCACTCGAAGCATACAAAAACCAAGT
ATAAAAGAATGACGGTAATTTCAAAAGTGCGTCTTATTGCCTTTCTTATCTAAGACTTCGATGCATCTGCGTGGCATGGACTCAATGAGTGACATCAGCA
GTGCATGAGGAATGGATTCCCAAGCCTCAAATAATGCAGCCTTCAATTGAGGCACACTATCAAATTGTCTTCCATTTGCATACACTCGCCTACTCATAAT
GGACCACAAATTCAAGAAGATAATGGAGTCCCAGATGACCTCGGTGTCCTTGCACAGCAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCG
GGCTTGAGGGGGAGCGTGTTCACCATCTTGGTGTACACCAACCAGTCCACCCTTGCTAGGGTGCGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCT
CCGACTTGAGCTGGGCAGCCGACAACATGCCCTTGGTAGCAGCGCGGATGAGACGGCGGGTCTCGCGGTCAGAGAGTGCCGGGGCAGGCCCAGGTCGCTT
GGCTTCTTGGTGTGGCGGTGTGGGCGTCGTGACGCGTCTGATGGTGTGTGTGCAGCTGTGACGGGGCACACAGCACCTTGCACAGAGGAAGTGCTAGAGA
GCGTAAGCTCTCGGTGAACAACAAGTTCACGGTTCCCGGTCTAAGGAAACCGACTACGACTTAGACGGTAGGTTTAAAGACTGAATATATTTATAGGTGA
GTCAAGCTTGATCCTTACAAACTCTAAGTCAACTATAGTAAAAGCTAAACAAGTGCCCAATGGTTGGCTCACCGCCAACCGGTACCACGTACCATGGGCA
CAAAAGAGAGACATCCCATCACCCTTTATGTAACATGGGTACACGTCGGTGTACCCCGTTACATCCTCCCCCACTTATCTGAGAATCACACTTTATTTTC
CAATCAGAAGGGAGAGAATTGGAACTCCCAAATTGGGAATTCCCGGGCGCAGCCACAGCACGGCTGGCGCGTCCTCTCGACAGTCACGCAGTGACTTGTG
TCCGTGGCGGACACTGCGAGGTGCTTCCTTGCACAAAGGACGATGTCGGCCGCGAAGCCGCCGTCCTTAGCAACTCGTGTTGCAGCGCTAGCAAGCGCAC
AGTGCTTCGGCACGGGATGCTACTGCATCCAAACTTGCGGTGGTTCTCCTTAACCACCTGCAGTTCACTTGGGAGGAGCCGTGGGCCCTCCCTGACACTT
CGTGTGTCTTGTGTCTCCCGTGTGGGTCGACACCATCCCGGGCATCACATAGCCCAAGAGTGGAGGGAGCTCGCAGTTCACCTCCAGCCATGATAGCGGA
CCCGCATGGGTTACGCTAGTCATGGCTGAGCGCGTGAAGCATCGGCGCCGTACATCATTCGTTGACCAAAGCACTAAGCATCGTGCTTCGTCGTAGTGAT
ACGACGGCTGCCATTAGCAGTCTGCTCATCACTAAGAGCATTTCGGGTAGAGCAGCAAGCTCCACCCCGCGTCTAGGTCGTCGTACCATAGACGCTTCGG
TGTCGGACATCGACACCGAGGTACCCATCGGTACTTGAAGCATGGTGAAGAGTTACATGCACTCTCTACCACCTTCACTCTGGTGCCGGCGATTGCTTCG
TGCATCGCCAAGACCAGAGCACGGTCGGAGTGTGTGCAAGCCTGCACGACACTCGGTCTTTTTCAAGACCACGATTGGCGTACGGGCCTGTGAGCCCATA
CGTCAGTGGTTCGCCGTGTACTACGGCTACCACTAGAACATTGAGATGTTCCGAGTGCGTGCAAGCATGCACGGCACTCATCACCACATGACCGCGTCGG
CGTACGGGGCTGTGCTCCCGTACGCCAGAGGTACGCCGCGTGCTCAATGTACCACGGCTGCCTCAAGTGCCGCAAGCGTGCAGCACTGATGCTGTACAGT
TGTTGGCTCATGCCAACAACAGCTTCCGTGAGGAAGCTAGTCTCTCTAGAGACCTGGGAGGAGAGGTATTTCCGAACCCTCCCCCTCTTACGATCGATCC
CCCTCCGGGGTGACCGAGTCGACCGCGGCTGGAATTCATCCAGCCCGGGAACAGTTTGAGTCTGTGCGACTTGACGTGGGAACGATATTACCCACGTCGG
GTGAAGCCACCATGGGCTCACCTGGTGTGTGGAACTATGTTACCCACACAGGTAGCGCAACCCGCGTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGGGC
GCGATATACATTGCGCCAGGCACGACGTCAACCATGTGACTCGTGCCGTGGATTGAAACATTGGGTTCTTCGGAACCCAAGCGCAGCTTGCGCTTCGGCA
TACAAGGGTCAGCAATACTGACACCCCGGCCTGTGGTAGCAGCTGATAACCGGCTGCACCATCGAGCCGACCGTGTCTGAGGAGCATAGCTCCGAGTCGT
TCATTGCGACTCCGGTCTGGTACGTGCCCAGACCCGACTTTCGGCGGCGATGGTGTCGTCGGCGGTCATCAGGACGTGGAACTAAGTTACCCATGTCTTG
GTGGCGGTGCCAGGAGTCTTATCGACTCCGTGTGGAACCCACACAGGAGGTGCTTATAGCAACCTCCAGCTGGCCACGATCTCGGCCGTGGACTTAAGCC
ACCGGTCCGGTAGTGCCACTCCGCACTACTGAAGTCGAAGCCCGTACGGCGCGACGACTTTTCGGCGATGGTCGCTGTGGTATAGCGCAGCCACACATGC
CGGGCAAGACGCCCTGTTCATCGGCTAAGCCTTTGGCGGTCCGCGAGGGTTACCCGCGATGGACATGGTCTTGCGACCTGTTGACGTAGTTATGCGTAAC
TACGTCAACAGAACTCTTCCAGGACGTTCCTGTTCAGAACAGAAGAAGAGTTCAACTCTTCAGGAGAGGTCTCCGGTTACAGGAGTACCATCTCCCCAGC
CTTCAGGCTGACCAGGAAGTTGTGCAGCGATATTCCCTCGAGGTTCAGAAACTCTGACACCTCCGGCAGGGCGGTCAAACTTATGACCGCCGCCTTGACC
TGACAGGTCTCGCCGTCGAAGATGTGATAGCATCTTCGGCCGGCCGTGCCTGAGGAGCGTTGATTACTCCGAGTCGCTCGTGGCGACTCCAGTCTGTTTC
AACAGACTCGGCTTACGGCGGCGACGACGTCGTCAATGCCTACCCCGGCGTGGTTCTTCGTTACCCACGGCCGGTGGTGACTCAAGGGCAGAGTCGGGAA
TCTCATCGACTCCGTGTGGCACATTGTTACCCACACAGGAGGTGCTCTCGGCAACCTCAGCCCTGGCCACGGTCTCGACCGTCTTGGCCTCACGTGGACT
TGTTCTACTGGGGAGCTGACATCCCCTGGCGCTGATACAGTCGAGACCTGTATGGCGCCACGATCAGGAGCGGTGGGTGCTGCTGGCGTTGCAGCTCCCC
TCGCTGGACTATTAGTCCTGTCCACCGGCATTGCCTGTGGCGGTCCATTGCCCGCAGTGGACGGTGTCTCAACACCTGTTGCAGCTGCAACTACTCCGAC
GACTTCCGTACGTCGGCGGACGCCATTGCGTCCTGGTAATCCTTTCGGATACCGTGTGTTCTGGCAGAGGTGGGTCATGACTCACCAATGCTCTGCCAGA
AGCTGGGTGCCGGTTAGCCTAGATGGCTTTCCGACACCAATTGCTTCAGGGTGCGTGCGTCCATGGCACGGCGCACCCAAGCGGACGCCGTACGTGTCCA
CGACCACGTACGGGTCGCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCTATGCAGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTC
CGGCGGCGTACGAAAGCATTCGACGCCCCTGGAACTAAACGTTCCTAGGGATATTAACATCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGC
CATCACCGATTCGAGACATAATGTCTCTCGTAGGCTAAGCCTCCATGGTGTGCGCTTCCGCACACCCGCACACACTCAACTCTCCCCCCTCTGGGGAACC
CGCCATTACTGGTGGCCGGAGTTCCCTCGGCCACCTGGCCGCGGCTTGCGCCAGCGACCGTTAGGCCCTCGGGGTTTGAGGGATGGGTTCTTCCCCACCC
CAGTCGAAGGACACACACGTTGGTAGTGTCCTAGTCCGCCGCATTTATAGCAGCGGACCGAGCCAAGCTCAGCAGAGCTCAAGTCCATAGGCTCTGGCTC
GTTGTTCGCAACGACAAGTTGCGCAACAACCGGAGTACCAGCCTGCTTATGGCTGTACTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGAT
GCATGCACGCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCCGTCCATGAAGACCGTCGTCTTGACGTCTTCGGGCAGGGGGTTCCCCACCAACG
ATGATGCCAACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCGCTTCCCTTGCTTACAGGCGAGGAAGCGTGAGCGCTGGCGGAACGCATCGTTCGC
CGGGAGAAACGCAGCGCGAAGCCGCTCGCACAACTGTTCCCAGGATGCAAAGCATCCAGGAGACGTCGTCTCCAGCATGTACGCCCAATTCTTGGCACGA
TCGCTTAGGTTGGACAACGCGAACGCAACGCGAAGTCCCTGATCCGAGATGAGACCCGCCCTCATGGCGATCTCAACTTCTCGGATCCAGAAGTGAAGGT
TTTCACCTTCCTTCCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGCTTCGGCTGGACCGGCTTCGGCTCGGCCACAGAGGCCTGCAGGTTTCTTTTTTT
GTTTTTTTTTTGTTTTTTGTATTATACGGATTATTGTGTTACATGCTTTCGCAGAACTCTAATAACCATGCGCGACTGGCCATTCCTTCCTGTCACGTGC
ATCACCTCTTCACACTCCGTCGCCTCTCCTCCTTCTTATAGCCCTCTGTTTATTGTTTGTGCCTCATCGCACCATCTTCTTCCTACCAGAAGCCGATGTC
GTTTCCTTGTCTGCTATCCGCCCCAACGTACAGCTCATGTGTTCTGTATTCCGTCGAGGCTCGCACTGTGATGCTCTGTTGTCTGTCCATGGCGTAATTG
GCGATCCAATCCGCCGTCTTGTTGTGCTGCCTGTAGTGGTGACTCCATGTTGCGACCCCGCATATAGCCGCCAACCGTTTAGTGACTCGATACCAATGCT
TCATCTTCTTCGATTTTGGTCTGTGCGTGTTCTTCATCCAACCGATGATAAGCGCACTATCACCAACCACATGTAAGTTGCTCCATTTCATTTCGACCGC
TTCTGCTAGGAGCCTTTGTAGCCCGACAAATTCTGCCACGTTATTAGTCATCGTTTGACCTCCCAACGCCGTCGCTGCTGCCCACAACAGTGTTCCTGTC
ACCTGTCCATTCGAGACTGCATCCCCAGTCAGCTCCACGACCACGCTACCACTTCCCCCGGGCCCTGGATTTCCCCGGGAGCCTCCGTCAAATAGGCCGA
TCCTCGTTGGGCCCGTCGGTGCTGTCAGTACCTTGCGCTCTGTTCCTACACTCCAAGCTTTGAGAAGATGACCCGCCGCGGCAAGTTTGGGTTTCGAGTC
CACCGTCAATGGATATAAACTCAGTGTGTAGCGCCTGCACGCTTCCAACAGCCCTTTTCGTAATCCTTCTGCAGCCTCCGCTAGTGTGACCTGCTGCGTG
CTTATCGCGTGCACGCGATTGACATTCCACCGCCAAATCGCTGTTACCGTTAAGGCACAGCCACTAGCCCATATATCCTGTGCCATATCATTATTTTCCT
CCCATTCCGTGTCTTGTTGTTGTATACCCCATTGAACAACCCAAGCCGGGAGGCATTTGAGCCGAAACCCAAAAATGTCCTCTATCATGTCCGCCCTGAG
CTGCTCTTGTGTACGTCCATCGTCCTCCCCGTTTCTCCACATGTGCAGCAGTACGTCCCAGAAAATTGCCGCCTCCGGGCATGTCCATATTAAGTGATCC
GCTCCTTGGCGTGTGTCCCCGCATATTATTCCGCCCTGCAATTGTATTGTGTTTCCTTGTTGCACCACAATCTCAACCTCCCCCACTTTAGCTTCATCAC
ATTCTGGACTTGATATGCTGGCACCCCTCCATCTTTTGAATTCGCCCCCACTGCACTACGCATAGTGCGTCCGCTATCTGCTTGTGTTGCTTCCGCCACT
TATCTTCTATCTTGTCGATCGCAATCTTCGCTTTATGCACACTACGCCGTGCTAACCGTACTTTGAATTGCTTCCTGGTCATGGACCACCTCCTTTTGCC
AGCCCAGAGTGGCCTCATTCGAGTTAACCAGGGGTGAGGGGTTACCCATAACCCCTGATCCTGAGCTTCAAGCCATCTCGCTGCCGCCTGGCTCACTGTT
TCTTTCCCTACTGCCCACGGCACCTTCTTGCTGCTAGACCCCATGTGTGATGCAACTCCGTGTCTCCCTTTCACAACCTCAAAACTATGGTGCTGGTCTT
CTAGATGGTGATGTACTATCAGTTCCTCTGGTCGTCTTCCTTTGAACACGGTCTCTGGATAGTTGGCTATAATGTTGCAGCATAGCTCCTTGAACAACTC
TGCTACTTTGCTGTTCATTGGTATTTTGTGCTGCACTGGTCTGAAAATCACTTGACCCATGTCCTTCCAATCTATGACTACCAGTTCACCTAATTTGACA
TGCGCAGGCCTGCTCACTAATATCGCCAGCTCTTGCCAAGTCATTATTCTTCCTCTTAGATCCCACATTTTCAGCGCTCTCAGCTCCACCCCTTCCATTC
CAGAGTGGAGAAAATCACCTCTCTCCTTTCTTCTTTTCCTCCTCACCTCATTAATTTTGTTCTTGATACTGTCACCACAGTTGACCTGGAGCCCCTCTGC
TTCCCACCGGAAAGTAACCCCGCTCGCAGCTCTCAGCTGCATCCGTATACCGCGCCCTTCCTCATCCTCTTTGTTTTCGTGCTTCACTCCATTTGTCATC
GCCCATTGCACCCATGGCCTCCCAGTACTCCAGAGATCATCCCCAGGTTCAGTGGTGGGCTCTTTCACTTGCTGTGATATATGACCCTTCCACTCTCCTC
CTCGCTGTTGCAGTAGATCGCCAGTAATCTGCATCAATGTGTTATCCGTCATTGCCCATGTCGCCACTGTTGTCGCGCTCATCGCTACTAATTCAGCTTC
AATATTTGGCAAACCAAGACCTCCCTGTTTTGCTGATCGTTCCGCCAAGTCTTTCTTGATCCATCCTGCAATTGTGGAGTCTGGTCTAGCAAAAGATGAC
TTCCATACAAAATTTCTTATCCGTTGATCTGCCTGCTTGATCACGTAACTCGGCGGCCAAGCGTGCCTCGCAACATATAGCAGCTTGGGCACTATAATTG
CTGCTGCGATTGTTGCGCGCTGCTGTGCTGTATTTGTTTTCTCCTGTGCCAGCGCTAACCTTACTGTAATTGCACGGAATGCACGATCCCATGCTTCGGA
TACTGTGTTACCTGTTCCTGCGAAATGCCCCAGGTACCGTGCTGTGTCTACTTCCGTAACCACCTGTTGTGTCTCCACTGCTGCAGCCTCGTCGTCTTCA
TCGTAGTGGAAATCCTTCTCCGATCCTAACCGAATCGCTACTGATTTGCGCACATTCAGCATCAGTCCCGAAACTTGCGAGAAGCGGCCAACGGCATTTA
TTGCAGCTCTCTGCATTGCTTTGTTTGCAATATAAATTGCCGTGTCATCGGCATACCCAGCTACCCTTAATTGATGTACCAACTTGCTGCTCGTTAAAGG
TATTCCTTGCAAACAAGGGTCCATCTCCACTTCGTCGTAAAGTAGGTCCACTGCAATGATAAAGAGTAGCGGTGCCAACGGACACCCCTGGCGGATTCCG
CTTGTTACTCCGACCTCCCTCGATAACTCGCCGTTTGCCAGAAACCTTACTGTGGTGTTTGTGTGAATGGCCTCCACGATCCTACAGAATTTTTCTGGGA
AGCCTTTAGCTTTTAGTACAGCATAAAGAAATTCCCTGTCTAAGGAATCATAAGCCTTGGCGAAGTCCAGCATCAATACTTGTGCTTCTGTCAGCTCTTC
CCCATGTTGGCATGCGTGCTTAGCTGCTTCAAACAAATCGATCGCCTCATGGATTGTCCTGCCGGGAATAAAACCGAATTATGTGCTATGTACTATGCTC
GCAATACGTTTCCTCAGCCGCCACGCTAAAATTCTCGTGAAAATCTTATAGTCTGAATTCAACAGAGCTATAGGCCTGTAGTTCAGCGGGTTGCTTGCAT
CACCCCCTTTACTGATACTGAAAATGAAGGCCTCTACGAAAGATTTCGGTGTGACTCCTTCCTCCATGGCACTGTTGAAGATTGTGAGTAAAACTGGTAT
CAACTCCTCTTGATTGTCTAAGTACCAGTCGTTGCTCAGTGAGTCTGGGCCGCATGCTTTTCCGCGCTTGCATTTTGCTATAGACATACTCACTTCCTCT
GCTGTTATCGGTTCATCCAATTCCACGAGATCCACTTTCTCCCATCTGTCCTGTACTCTGTTGATGTAATTTCTCTCGTTTGATCGACCTCCGCCGCACC
ATTGAGAATCGGTTCCCAGCTTTCGGCGAGAATATCCGCTTTTTGTTGTGCATGCAAAGTGGAGCCTGCTATTGTTGACTGCAAATGCGGGATTGTATTA
TCTCCGTACTTCGTGCATATTCGTCGATAAAATTGCTTCGTCGTTCTTTTGGAACTCCAAGCATTGCTGGCAACTAGACAGCGACGTCTTGAAGCACCTC
TTTCCCCTTGCACGTTGGCCAATTCATCCCAGTAATTGTTGTCTATGCAGCTGGTGCTCCGGTTGCGTATATCCACACTTCCCCAATTTGATCTTGATTC
GTCTTATTCGTTGCCTGAAGCCTCTTGTTGTTCTGCGCCTCGCCTCTTTTTTTAGCTGCGTCATTTCTCCTGTTAGCTCGCGCTTGAATTGATCCCACTT
GACCACACTGCTTTCTTCACCTCCACTCTGTATTATGCCGCCAGCTCTCTTAACTTATACTCGATCAAACTCTTGGTGACCGTTTCAGCGTACGGCGGCG
GTGGGTAGAGTTTTGGCCTCCGTCTGATCCTGACTATTCCTCTGGGTGAGTGGAGCTCTAATATTACCCCTCTGTGGTCCGCTTGGCAGAAGGACTCCAC
TACTTGTATTCCCCGCAACATTTTGCGATCCACAGCGGTGATATACCATCGGTCTATTCGTGATGACCCGATCATTCCATCTGCCGCTGGTTGCTTGTGC
GTGTGATACGTGTCAGCATATTTCCTCCGCTCACTGTAATTGTTTTGTGGAATCGTGTAATTTCCTGCATCTTCTAGGCCATTCAGCTGAATGACCTGTT
CAAGCGCTCTTGCTCCCATGTCATCTCTGTTGCAGCTTCCAATTCTGTCTATGTTCACGTCGAGCACACAGTTGTAGTCTCCTCCCATATCATCGAAATA
CCAATCGGGAAAGGTATCCTTCGTAAATTGTTAAAAAATGTGATCCTTGCTAGCCCAGCCGATGGTGCATATATGTTGAGGAAAAGAATGACTTCCCTCC
AATGATCCCCACTATCATCATGAGATGCTCGTTCCAGTACTCTGTACCCCATTCTTTGACTTCCTTGACCGCTCCGTAAGGATTGACAAGTATGGCTACC
CCAGCCCTTCTATCGGCCCCGGACGACCACAGCGAGTACTTATACGCCGCCGTGTGCTTGTATCCCCACATTGCTGCATACTGTTGCGCAGCTGTCGTGT
TTTCTTCTTCCCTCAAAT