Description :
From Genome Similarity Track
Location :
contig_42:543815- 557733
Transcript NameFunction/comments
g9582.t1hypothetical protein

Sequence
13918 bases(100 bases per row)
TCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCTTTGGGCTATGAATGTGGACCACCTTGTGGAGTGGTCACCTGAATGTATCCCTTAGTGCAT
GTTACACTACGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACAGTGAGACCCACCTTCAACAATCGAGCGTTGTAATAGCAATTATGCCATACTCGCT
GTTGTCGGATCCATGGACGTCTTGGTTGCGCCGATCGTGAATTTCATTATGTTTTCCTTGATTGTTGCGGCAGGGATTTCCACGACGATCATGGCGTTTC
CATTAGGAGAACGATTGTTGTTTTCACGACCATGGTAGTTGGTCCACGAGTTTTTTTTGCCATGGTTTCCCTTGTAGCTGCCTTTGAAAGGGTAATGACT
TTGCGTGCCTTGTGTTGCCTTGAGCAGGAAGAGCCGTGTCAGTCTTGATTTCGCCATCACGTAGGTGACGCTGCAGGATGCAGCGGTCGACTGTGTCGTG
GTTGTCGCGCTGGCAGTACGTGCACTTCACTGAAGCCACGACAACTTTTTTTCATCTTGGTGGGGACTCGGAGATTCGCTGGCATCGGAATTGGTGATAT
GGCTTGAACAGCTCTCTCAGCTCGTGTTTACTTAGACTGGGGTTTCTTGTCCGAGGATGTAGCGATTGCGCGCTAGCTCATTCTGGACCTTGGTCTCGAC
GTGCCGTTTCAGGTCTTCGTACGGAATAAACTTCCGACTGCCTTTCCAGACTGCTAGTTCAGGCTTCCACTCCGTTGGGAAGGAATGGTACAGACAGAGC
GACCTTTGGTCGTCGCTCAGCACACTGTTCGTGGCTTCCGCGGCTGCCTTCATAGATTCAACCAAGTCAATGATGAAATCCATCCTTCCTCGTATTTGAG
GGCCATCAGGTACGGCTGAATGTAGTACGGGTCACTGCGGATGGCAGCAACTTCGTACTCCTTATCCTTCACCACGAGAACGTGTTGATCATCGATGGTT
TTGATGAGGAAGGCTTTAGCCTTTGCTTCATCGAGCCGTAGATTCCTCGAGCTCAGTTTTAGGCTCTTAGCCTCTAGCTTCTCCGCTCGCTTCAGATCAT
CACGCTTTTTAGCAGTGAATGACTGGATCAAGGGTGGTTGTATCTACCCCATTTCCACGTCGCCGTCGTCTCCAACGGTGGCAGACTTCGAACTTGAGTC
GTCCATGTCGTTGGCCTTGGGTGCCCCAACGGCGTCTAGCGCGGCCTTAATGTCCCTCATGTCCGCCAATACCGGGTTGAGGTCTTCATCCGAGGAGAAG
TCGTAGTCCTCGTCGCCCGCATAGTCGGCTTCGAGGGCGGCGGTCACTCGAGTGTTCCAGATCACGAAGTTCCGGCCACTGAGGCACGGAAAATCGTGGT
CGTCGGTGCTTGAGTCAGTATTTGGGCTCATAGCCTGTCAAGGTCGTCGGAAGAGGAGCAGCAGAGGTGAGACAGCTTATGTAACTAAGGGTAAATTGGG
CAACTTGGTAAATCCTACCTATAACCTAACCCCTCTTTCTTAAGACCCGCTTTTATGGGTCAGATTGGCCAAAAGTCGGGAAAGGCACAATACTTCGAGC
TTGCACCCAAAGTGCTCTTGGTTTTCTGGCTTTCCCATATTCCGTGTACTTCACATAAACCTCGTGTAGAGCTTGATACTTCCTCCGCGCGGGAATTATT
GCAAGAATGTACTATCCACAGACCCAAGACTCTTGAAAGGAATTGCAGTAAAATATGATATTATGTAGGTACAACAGTAAGGAAGGCTCTCTCTCTCTAT
ATTCGATCATACATCAATTACGACTCCTTCATGAAGAATGGCGACAGCGTAGCGAAATGCCTCTAAATCGCATGGTAACGATTGGGGGAGCTTTCCTAGA
CGGCGCAGCTTGTCCTATCCGATGTGAGGAAGCTTGTACTCGTTCGAACCACCGGCGCGCATTGTACACTCGAAAACCTTCTGCAAGGTGAGAAAGATAT
TGTCCAGCTTCTCATGTTCGAGTGCGTCGTACGATTTCCTTACCGCACGAATAAGCTGGTCGATGTTGTAGTAGTCTTCTTGATACTGGAGAGCTTGTAT
CGAAGAGAAGTATCCCAAATCAAGGGTATATAATCTGGAGAGTTTGCCGGCTGAAACTCGAGATGTTCATCGTGCACGCCCAGCGGCGAGGATATCTGGA
TCATTGGGTTTGCAGTGAGATGTAGCATTATCATGTTGGATGATGATTGGCATACCTTTCTCACAAATTGGCCACTTGGCCTTGATTGCTGGTATAACAT
GTTCAAGCAGGTAGCGCTTGTAGACTTTACCATTGGCAGAATCTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCGTAGTGTAACATGCACTAAGGG
ATACATTCAGGTGACCACTCCACAAGGTGGTCCACATTCATAGCCCAAAGCATATGACTGGTAGAAAGTAACATCTTTCTACCAATGAGGGCCATTCAAT
AGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTTATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGC
ACCAAAACTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTAAATAACTCCTACGCTTCCTCATACACG
TGCGCACGCGTGTAAGCTTAAGCAGTGGGTCTAAGCAGACCCATTACAGAAACCAAGTTCTTCGTCCTGATCGTTCCTGCCAGTCGGTTCTTGCTGGTGC
GCTGCGCTTCTGTTTGCTTCGTAAAATCCCAGATGCCAATTTTCCCGTCAAATAAAACCTGTCCATTTGCATCATATCTGCAAATAATAAAAACAATAAA
TATCAGAGACTGAACAAAATTGATAAGTTGTGCAGGTTACGTTTACCTTGGTCTAGCTATTGCAGCCAGGAAAATTGTCTTGCCGATGAATCGCTTGCTT
TTACGCTCGCGATGAGGCACGGTCTCCCCTGGCAGAACGTAGAAGGCCCTCTTGTTTGTGTCCTCGTTGAACCACTTCTCGTCCACATGCACGACGTTGT
ACGGGGCGAGAAGTGGGAGCCATCAGATCCGTGGACCACGTGGCGAAGAGCGTGCCGAATTCGAGCATGCTTGTTCTCGTTCGTCAAGAGCGGGTGGATG
GTGTTGGTGTGGCGCAGGAGCTGGCCCTGCACGATCGCGTCCCACACCACAGAGCGCGCTACGTCCAGCTCATCTGCCAGACACTGTTGTGTCATGCGCC
GACGAAACGGAATGGTGGTGATGCGCGCTAAAAGCGCTTGCCGGTCTTTCTTCTTGCGGCCGGCTGCCTCCGGCATCCTGCTAACCACGCCGTCGATCCC
GTCGCTGGCAAATGCCGACTTAAACAGGCCCCAGACTCGGCTAATGGTGCTGATGTCCACACTAAATTTCTCAGCAGCATGGCTCATGGCTCCTCTGTCG
GGGCGACCGTGCTCACCGTTCAGCAGTAGAAAAATCATAGCATCCTTTCGCTCTCTGTCGGTGAGGTTTGGCTTGGATGGCGTGGTTCGGGCGCTCATGC
GGGGGGACTGGTTGCTGGTGGCGTGCTTGCGAGATGGGGTAATTTGGGTAATGAGGATGCCCCATGCGTACACTTTCGCTCGTAACTTTCTTGTTTGAAG
GATTTTTTTGGCGCTCAAAAGACGCGCGAAAAGCTGAGAGCAAATGGCGTCGATTCCGCCTATCAGCGGGCTCAAAGCGAGCCCATGAGGGAAAAAAGAT
CGGACCCATCTGTTTTTCGTTGCAATTATTTTCACCCAGAGGAAGTATGACATTACCTTGTCATACTTGTGTGTTCTCTACGTAATGTATCCATTCCGCA
TTTGAATGGAGACCAAGGCTCCACTATACTCCGCGACAAGATAAATCACCCACCCTCGTTTGAGGGCACAGCTCTGTCAATATTACGAGTTAGCTATTGC
TGTTTAGATATGCTTCTTCTGTCACCAATAGACCAACGTGGTTTGTGCTAACGATTGCAATTTCGCAGCGTGCGGGGGACCTCCAATACAAAATTCCATT
TAAGCATAGCGACACATTAGATCACCCACTCGAAGCATACAAAAACCAAGTATAAAAGAATGACGGTAATTTCAAAAGTGCGTCTTATTGCCTTTCTTAT
CTAAGACTTCGATGCATCTGCGTGGCATGGACTCAATGAGTGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCTCAAATAATGCAGCCTTCAATTG
AGGCACACTATCAAATTGTCTTCCATTTGCATACACTCGCCTACTCATAATGGACCACAAATTCAAGAAGATAATGGAGTCCCAGATGACCTCGGTGTCC
TTGCACAGCAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCGGGCTTGAGGGGGAGCGTGTTCACCATCTTGGTGTACACCAACCAGTCCA
CCCTTGCTAGGGTGCGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGACTTGAGCTGGGCAGCCGACAACATGCCCTTGGTAGCAGCGCGGAT
GAGACGGCGGGTCTCGCGGTCAGAGAGTGCCGGGGCAGGCCCAGGTCGCTTGGCTTCTTGGTGTGGCGGTGTGGGCGTCGTGACGCGTCTGATGGTGTGT
GTGCAGCTGTGACGGGGCACACAGCACCTTGCACAGAGGAAGTGCTAGAGAGCGTAAGCTCTCGGTGAACAACAAGTTCACGGTTCCCGGTCTAAGGAAA
CCGACTACGACTTAGACGGTAGGTTTAAAGACTGAATATATTTATAGGTGAGTCAAGCTTGATCCTTACAAACTCTAAGTCAACTATAGTAAAAGCTAAA
CAAGTGCCCAATGGTTGGCTCACCGCCAACCGGTACAACGTACCATGGGCACAAAAGAGAGACATCCCGTCACTCTTTATGTAACATGGATACACGTCGG
TGTACCCCGTTACATCCTCCCCCACTTATCTGAGAATCACACTTTATTTTCCAATCAGAAGGGAGAGAATTGGAACTCCCAAATTGGGAATTCCCGGGCG
CAGCCACAGCACGGCTGGCGCGTCCTCTCGACAGTCACGCAGTGACTTGTGTCCGTGGCGGACACTGCGAGGTGCTTCCTTGCACAAAGGACGATGTCGG
CCGCGAAGCCGCCGTCCTTAGCAACTCGTGTTGCAGCGCTAGCAAGCGCACAGTGCTTCGGCACGGGATGCTACTGCATCCAAACTTGCGGTGGTTCTCC
TTAACCACCTGCAGTTCACTTGGGAGGAGCCGTGGGCCCTCCCTGACACTTCGTGTGTCTTGTGTCTCCCGTGTGGGTCGACACCATCCCGGGCATCACA
TAGCCCAAGAGTGGAGGGAGCTCGCAGCTCACCTCCTGCCATGATAGCGGACCCGCATGGGTTACGCTAGTCATGGCTGAGCGCGTGAAGCATCGGCGCC
GTACATCATTCGTTGACCAAAGCACTAAGCATCGTGCTTCGTCGTAGTGATACGACGGCTGCCATTAGCAGTCTGCTCATCACTAAGAGCATTTCGGGTA
GAGCAGCAAGCTCCACCCCGCGTCTAGGTCGTCGTACCATAGACGCTTCGGTGTCGGACATCGACACCGAGGTACCCATCGGTACTTGAAGCATGGTGGA
GAGTTACATGCACTCTCTACCACCTTCACTCTGGTGCCGGCGATTGCTTCGTGCATCGCCAAGACCAGGGCACGGTCGGAGTGTGTGCAAGCCTGCACGA
CACTCGGTCTTTTTCATGACCACGATGGCGTACGGGCCTGTGAGCCCATACGTCAGTGGTTCGCCGTGTACTACGGCTACCACTAGAACATTGAGATGTT
CCGAGTGCGTGCAAGCATGCACGGCACTCATCACCATGTGACCGCGTCGGCGTACGGGGCTGTGCTCCCGTACGCCAGAGGTACGCCGCGTGCTCAATGT
ACCACGGCTGCCTCAAGTGCCGCAAGCGTGCAGCACTGATGCTGTACAGTTGTTGGCTCATGCCAACAACAGCTTCCGTGAGGAAGCTAGTTTCTCTAGA
GACCTGGGAGGAGAGGTATTTCCGAACCCCTCCCCCTCTTACGATCGATCCCCCTCCGGGGTGACCGGGTCGACCGCGGCTGGAATTCTTCCAGCCCGGG
AACAGTTTGAGTCTGTGCGACTTGACGTGGGAACGATATTACCCACGTCGGGTGAAGCCACCATGGGCTCACCTGGTGTGTGGAACTATGTTACCCACAC
AGGGAGCGCAACCCGCGTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGGGCGCGATATACATTGCGCCAGGCACGACGTCAACCATGTGACTCGTGCCGT
GAAGTGAAACACTGGGTTCTTCGGAACCCAAGCGCAGCTTGCGCTTCGGCATACAAGGTTCAGCAATGCTGACACCTCGGCCTGTGGTAGCAGCTGATAA
CCGGCTGCACCATCGAGCCGACCGTGTCTGAGGAGCATAGCTCCGAGTCGTTCATTGCGACTCCGGTCTGGTACGCGCCCAGACCCGACTTTCGGCGGCG
ACGGTGTCGTCGGCGGTCATCAGGACGTGGAACTAAGTTACCCACGTCTTGGTGGCGGTGCCAGGAGTCTTATCGACTCCGTGTGGAACCCACACAGGAG
GTGCTTATAGCAACCTCTAGCTGGCCACGATCTCGGCCGTGGACTTAAACCACCGGTCCGGTAGTGCCACTCGGCACTACTGAAGTCGAACCCCGTGCGG
CGCGACGACTTCTCGGCGATGGTCGCTGTGGTATAGCGCAGCCACACAAGCCGGACAAGACGCCCTGTCCATCGGCTAAGCCTTTGGCGGTCCGCGAGGG
TTACCCGCGATAGACATGGTCTTGCGACCTGTTGACGTAGTTATGCGTAACTACGTCAACGGAACACTTCCAGGACGTTCCTGTCCAGAACAGAAGAAGA
GTTCAACTCTTCAGGAGAGGTCTCCGGTTACAGGAGTAGGTTCAGAAACTCTGACACCTCCGGCAGGGCGGTCAAGCTTATGACCCCCTCCTTGACCTGA
CAGGTCTTGCCGTCAAAGATGTGATAGCATCTTCGGCCGGCCGTGCCTGAGGAGTGTTGATCACTCCGAGTCGCTCGTGGCGACTCCAGTCTGTTTCAAC
AGACTCGGCTTACGGCGGCGACGACGTCGTCAATGCCTACCCCGGCGTGGTTCTTCGTTACCCACGGCCGGTGGTGACTCAAGGGCAGAGTCGGGAATCT
CATCGACTCCGTGTGGCACATTGTTACCCACACAGGAGGTGCTCTCGGCAACCTCAGCCCTGGCCACGGTCTCGACCGTCTTGGCCTCACGTGGACTTGT
TCTACTGGGGAGCTGACATCCCCTGGCGCTGATACAGTCGAGCCTGTATGGCGCCACGATCAGGAGCGGTGGGTGCTGCTGGCGTTGCAGCTCCCCTCGC
TGGACTATTAGTCCTGTCCACCGGCATTGCCTGTGGCGGTCCATTGCCCGCAGTGGACGGTGTCTCAACACCTGTTGCAGCTGCAACTACTCCGACGACT
TCCGTACGTCGGCGGACGCCATTGCGTCCTGGTAATCCTTTCGGATACCGTGTGTTCTGGCAGAGGTGGGTCATGACTCACCAATGCTCTGCCAGAAGCT
GGGTGCCGGTTAGCCTAGATGGCTTTCCGACACCAATTGCTTCAGGGTGCGTGCGTCCATGGCACGGCGCACCCAAGCGGACGCCGTACGTGTCCACGAC
CACGTACGGGTCGCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCTATGCAGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGC
GGCGTACGAAAGCATTCGACGCCCCTGGAACTAAACGTTCCTAGGGATATTAACATCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGCCATC
ACCGATTCGAGACATAATGTCTCTCGTAGGCTAAGCCTCCATGGTGTGCGCCACACCCGTCACAGACTCAACTCTCCCCCCTCTGGGGAACCCGCCATTA
CTGGTGGCCGGAGTTCCCTCGGCCACCTGGCCGCGGCTTGCGCCAGCGACCGTTAGGCCCTCGGGGTTTGAGGGATGGGTTCTTCCCCACCCCAGTCGAA
GGACACACACGTTGGTAGTGTCCTAGTCCGCCGCATTTATAGCAGCGGACCGAGCCAAGCTCAGCAGAGCTCAAGTCCATAGGCTCTGGCTCGTTGTTCG
CAACGACAAGTTGCGCAACAACCGGAGTACCAGCCTGCTTATGGCTGTACTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGATGCATGCAC
GCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCCGTCCATGAAGACCGTCGTCTTGACGTCTTCGGGCAGGGGGTTCCCCACCAACGATGATGCC
AACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCACTTCCCTTGCTTACAGGCGAGGAAGCGTGAGCGCTGGCGGAACGCATCGTTCGCCGGGAGAA
ACGCAGCGCGAAGCCGCTCGCACAACTGTTCCCAGGATGCAAAGCATCCAGGAGACGTCGTCTCCAGCATGTACGCCCAATTCTTGGCACGATCGCTTAG
GTTGGACAACGCGAACGCAACGCGAAGTCCCTGATCCGAGATGAGACCCGCCCTCATGGCGATCTCAACTTCTCGGATCCAGAAGTGAAGGTTTTCACCT
TCCTTCCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGCTTCGGCTGGACCGGCTTCGGCTCGGCCACAGAGGCCTGCAGGTTTCTTTTTTTGTTTTTTT
TTTGTTTTTTGTATTATACGGATTATTGTGTTACATGCTTTCGCAGAACTCTAATAACCATGCGCGACTGGCCATTCCTTCCTGTCACGTGCATCACCTC
TTCACACTCCGTCGCCTCTCCTCCTTCTTATAGCCCTCTGTTTATTGTTTGTGCCTCATCGCACCATCTTCTTCCTACCAGAAGCCGATGTCGTTTCCTT
GTCTGCTATCCGCCCCAACGTACAGCTCATGTGTTCTGTATTCCGTCGAGGCTCGCACTGTGATGCTCTGTTGTCTGTCCATGGCGTAATTGGCGATCCA
ATCCGCCGTCTTGTTGTGCTGCCTGTAGTGGTGACTCCATGTTGCGACCCCGCATATAGCCGCCAACCGTTTAGTGACTCGATACCAATGCTTCATCTTC
TTCGATTTTGGTCTGTGCGTGTTCTTCATCCAACCGATGATAAGCGCACTATCACCAACCACATGTAAGTTGCTCCATTTCATTTCGACCGCTTTGCTAG
GAGCCTTTGTAGCCCGACGAATTCTGCCACGTTATTAGTCATCGTTTGACCTCCCAACGCCGTCGCTGCTGCCCACAACAGTGTTCCTGTCACCTGTCCA
TTCGAGACTGCATCCCCAGTCAGCTCCACGACCACGCTACCACTTCCCCCGGGCCCTGGATTTCCCCGGGAGCCTCCGTCAAATAGGCCGATCCTCGTTG
GGCCCGTCGGTGCTGTCAGTACCTTGCGCTCTGTTCCTACACTCCAAGCTTTGAGAAGATGACCCGCCGCGGCAAGTTTGGGTTTCGAGTCCACCGTCAA
TGGATATAAACTCAGTGTGTAGCGCCTGCACGCTTCCAACAGCCCTTTTCGTAATCCTTCTGCAGCCTCCGCTAGTGTGACCTGCTGCGTGCTTATCGCG
TGCACGCGATTGACATTCCACCGCCAAATCGCTGTTACCGTTAAGGCACAGCCACTAGCCCATATATCCTGTGCCATATCATTATTTTCCTCCCATTCCG
TGTCTTGTTGTTGTATACCCCATTGAACAACCCAAGCCGGGAGGCATTTGAGCCGAAACCCAAAAATGTCATCTATCATGTCCGCCCTGAGCTGCTCTTG
TGTACGTCCATCGTTCTCCCCGTTTCTCCACATGTGCAGCAGTACGTCCCAGAAAATTGCCGCCTCCGGGCATGTCCATATTAAGTGATCCGCTCCTTGG
CGTGTGTCCCCGCATATTATTCCGCCCTGCAATTGTATTGTGTTTCCTTGTTGCACCACAATCTCAACCTCCCCCATTTTAGCTTCATCATATTCTGGAC
TTGATATGCTGGCACCCTTCCATCTTTTGAATTCGCCCCCACTGCACTACGCATAGTGCGTCCGCTATCTGCTTGTGTTGCTTCCGCCACTTATCTTCTA
TCTTGTCGATCGCAATCTTCGCTTTATGCACACTACGCCGTGCTAACCGTACTTTGAATTGCTTCCTGGTCATGGACCACCTCCTTTTGCCAGCCCAGAG
CGGCCTCATTCGAGGTAACCAGGGGTGAGGGGTTACCCATAATCTCTGATCCTGAGCTTCAAGTCATCTCGCTGCCGCCTGGCTCACTGTTTCTTTCCCT
ACTGCCCACGGCACCTTCTTGCTGCTGGACCCCATGTGTGATGCAACTCCGTGTCTCCCTTTCACAACCTCAAAACTATGGTGCTGGTCTTCTAGATGGT
GATGTACTATCAGTTCCTCTGGTCGTCTTCCTTTGAACACGGTCTCTGGATAGTTGGCTATAATGTTGCAGCATAGCTCCTTGAACAACTCTGCTACTTT
GCTGTTCATTGGTATTTTGTGCTGCACTGGTCTGAAAATCAAGTGACCCATGTCCTTCCAATCTATGACTACCAGTTCACCTAATTTAACATGCGCAGGC
CTGCTCACTAATATCGCCAGCTCTTGCCAAGTCATTATTCTTCCTCTTAGATCCCACATTTTCAGCGCTCTCAGCTCCACCCCTTCCATTCCAGAGTGGA
GAAAATCACCTCTCTCCTTTCTTCTTTTCCTCCTCACCTCATTAATTTTGTTCTTGATACTGTCACCACAGTTGACCTGGAGCCCCTCTGCTTCCCACCG
GAAAGTAACCCCGCTCGCAGCTCTCAGCTGCATCCGTATACCGCGCCCTTCCTCATCCTCTTTGTTTTCGTGCTTCACTCCATTTGTCATCGCCCATTGC
ACCCATGGCCTCCCAGTACTCCAGAGATCATCCCCAGGTTCAGTGGTGGGCTCTTTCACTTGCTGTGATATATGACCCTTCCACTCTCCTCCTCGCTGTT
GCAGTAGATCGCCAGTAATCTGCATCAATGTGTTATCCGTCATTGCCCATGTCGCCACTGTTGTCGCGCTCATCGCTACTAATTCAGCTTCAATATTTGG
CAAACCAAGACCTCCCTGTTTTGCTGATCGTTCCGCCAAGTCTTTCTTGATCCATCCTGCAATTGTGGAGTCTGGTCTAGCAAAAGATGACTTCCATACA
AAATTTCTTATCCGTTGATCTGCCTGCTTGATCACGTAACTCGGCGGCCAAGCGTGCCTCGCAACATATAGCAGCTTGGGCACTATAATTGCTGCTGCGA
TTGTTGCGCGCTGCTGTGCTGTATTTGTTTTCTCCTGTGCCAGCGCTAACCTTACTGTAATTGCACGGAATGCACGATCCCATGCTTCGGATACTGTGTT
ACCTGTTCCTGCGAAATGCCCCAGGTACCGTGCTGTGTCTACTTCCGTAACCACCTGTTGTGTCTCCACTGCTGCAGCCTCGTCGTCTTCATCGTAGTGG
AAATCCTTCTCCGATCCTAACCGAATCGCTACTGATTTGCGCACATTCAGCATCAGTCCCGAAACTTGCGAGAAGCGGCCAACGGCATTTATTGCAGCTC
TCTGCATTGCTTTGTTTGCAATATAAATTGCCGTGTCATCGGCATACCCAGCTACCCTTAATTGATGTACCAACTTGCTGCTCGTTAAAGGTATTCCTTG
CAAACAAGGGTCCATCTCCACTTCGTCGTAAAGTAGGTCCACTGCGATGATAAAGAGTAGCGGTGCCAACGGACACCCCTGGCGGATTCCGCTTGTTACT
CCGACCTCCCTCGATAACTCGCCGTTTGCCAGAAACCTTACTGTGGTGTTTGTGTGAATGGCCTCCACGATCCTACAGAATTTTTCTGGGAAGCCTTTAG
CTTTTAGTACAGCATAAAGAAATTCCCTGTCTAAGGAATCATAAGCCTTGGCGAAGTCCAGCATCAAAACTTGTGCTTCTGTCAGCTCTTCCCCATGTTG
GCATGCGTGCTTAGCTGCTTTAAACAAATCGATCGCCTCATGGATTGTCCAGCCGGGAATAAAACCGAATTGTGTGCTATGTACTATGCTCGCAATACGT
TTCCTCAGCCGCCACGCTAAAATCCTCGTGAAAATCTTATAGTCTGAATTCAACAGAGCTATAGGCCTGTAGTTCAGCGGGTTGCTTGCATCACCCCCTT
TACTGATACTGAAAATGAAGGCCTCTACGAAAGATTTCGGTGTGACTCCTTCCTCCATAGCACTGTTGAAGATTGTGGTTAAAACTGGTATCAACTCCTC
TTGATTGTCTAAGTACCAGTCGTTGCTCAGTGAGTCTGGACCGCATGCTTTTCCGCGCTTGCATTTTGCTATAGACATACTCACTTCCTCTGCTGTTATC
GGTTCATCCAATTCCACGAGATCCACTTTCTCCCATCTGTCCTTTACTCTGTTGATGTAATTTTCTTTCGTTTGATCGGCCTCCGCCGCACCATTGAGAA
TCGGTTCCCAGCTTTCGGCGAGAATATCCGCTTTTTGTTGTGCATGCAAAGTGGAGCCTGCTATTGTTGACTGCAAATGCGGGATTGTATTATCTCCGTA
CTTCGTGCATATTCGTCGATAAAATTGCTTCGTCGTTCTTTTGGAACTCCAAGCATTGCTGGCAACTAGACAGCGACGTCTTGAAGCACCTCTTTCCCCT
TGCACTTTGGCCAATTCATCCCAGTAATTGTTGTCTATGCAGCTGGTGCTCCGGTTGCGTATATCCGCACTTCCCCAATTTGATCTTGATTCGTCTTATT
CGTTGCCTGAAGCCTCTTGTTGTTCTGCGCCTCGCCTCTTTTTTTAGCTGCGTCATTTCTCCTGTTAGCTCGCGCTTGAATTGATCCCACTTGACCACAC
TGCTTTCTTCACCTCCACTCTGTATTATGCCGCCAGCTCTCTTAACTTATACTCGATCAAACTCTTGGTGACCGTTTCAGCGTACGGCGGCGGTGGGTAG
AATTTTGGCCTCCGTCTGATCCTGACTATTCCTCTGGGTGAGTGGAGCTCTAATATTACCCCTCTGTGGTCCGCTTGGCAGAAGGACTCCACTACTTGTA
TTCCCCGCAACATTTTGCGATCCACAGCGGTGATATACCATCGGTCTATTCGTGATGACCCGATCATTCCATCTGCCGCTGGTTGCTTGTGCGTGTGATA
CGTGTCAGCATATTTCCTCCGCTCACTGTAATTGTTTTGTGGAATCGTGTAATTTCCTGCATCTTCTAGGCCATTCAGCTGAATGACCTGTTCAAGCGCT
CTTGCTCCCATGTCATCTCTGTTGCAGCTTCCAATTCTGTCTATGTTCACGTCGAGCACACAGTTGTAATCTCCTCCCCAAATCATCGAAATACCAATCG
GGAAAGGTATCCTTCGTAAATTGTTAAAAAATGTGATCCTTGCTAGCCCAGCCGATGGTGCATATATGTTGAGGAAAAGGAAAAACTTCCCTCCAATGAT
CCCCACTATCATCATGAGATGCTCGTTCCAGTACTCTGTACCCCATTCTTTGACTTCCTTGACCGCTCCGTAAGGATTGACAAGTATGGCTACCCCAGCC
CTTCTATCGGCCCCGGACGACCACAGCGAGTACTTATACGCCGCCGTGTGCTTGTATCCCCACATTGCTGCATACTGTTGCGCAGCTGTCGTGTTTTCTT
CTTCCCTCAAATGTGTTT